ID: 1040567881

View in Genome Browser
Species Human (GRCh38)
Location 8:48582885-48582907
Sequence CTGACTCTCCCAGACCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040567881_1040567887 -1 Left 1040567881 8:48582885-48582907 CCTTGTGGGTCTGGGAGAGTCAG No data
Right 1040567887 8:48582907-48582929 GGGAGGAGTCTGGTGAGGTCTGG No data
1040567881_1040567894 22 Left 1040567881 8:48582885-48582907 CCTTGTGGGTCTGGGAGAGTCAG No data
Right 1040567894 8:48582930-48582952 GCCCTGCTGGGAACTGGGGACGG No data
1040567881_1040567889 9 Left 1040567881 8:48582885-48582907 CCTTGTGGGTCTGGGAGAGTCAG No data
Right 1040567889 8:48582917-48582939 TGGTGAGGTCTGGGCCCTGCTGG No data
1040567881_1040567886 -6 Left 1040567881 8:48582885-48582907 CCTTGTGGGTCTGGGAGAGTCAG No data
Right 1040567886 8:48582902-48582924 AGTCAGGGAGGAGTCTGGTGAGG No data
1040567881_1040567893 18 Left 1040567881 8:48582885-48582907 CCTTGTGGGTCTGGGAGAGTCAG No data
Right 1040567893 8:48582926-48582948 CTGGGCCCTGCTGGGAACTGGGG No data
1040567881_1040567891 16 Left 1040567881 8:48582885-48582907 CCTTGTGGGTCTGGGAGAGTCAG No data
Right 1040567891 8:48582924-48582946 GTCTGGGCCCTGCTGGGAACTGG No data
1040567881_1040567888 0 Left 1040567881 8:48582885-48582907 CCTTGTGGGTCTGGGAGAGTCAG No data
Right 1040567888 8:48582908-48582930 GGAGGAGTCTGGTGAGGTCTGGG No data
1040567881_1040567890 10 Left 1040567881 8:48582885-48582907 CCTTGTGGGTCTGGGAGAGTCAG No data
Right 1040567890 8:48582918-48582940 GGTGAGGTCTGGGCCCTGCTGGG No data
1040567881_1040567892 17 Left 1040567881 8:48582885-48582907 CCTTGTGGGTCTGGGAGAGTCAG No data
Right 1040567892 8:48582925-48582947 TCTGGGCCCTGCTGGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040567881 Original CRISPR CTGACTCTCCCAGACCCACA AGG (reversed) Intergenic
No off target data available for this crispr