ID: 1040567882

View in Genome Browser
Species Human (GRCh38)
Location 8:48582886-48582908
Sequence CTTGTGGGTCTGGGAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040567872_1040567882 2 Left 1040567872 8:48582861-48582883 CCCCAGGACGGTGGTTTTGGGGG No data
Right 1040567882 8:48582886-48582908 CTTGTGGGTCTGGGAGAGTCAGG No data
1040567875_1040567882 0 Left 1040567875 8:48582863-48582885 CCAGGACGGTGGTTTTGGGGGCC No data
Right 1040567882 8:48582886-48582908 CTTGTGGGTCTGGGAGAGTCAGG No data
1040567874_1040567882 1 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567882 8:48582886-48582908 CTTGTGGGTCTGGGAGAGTCAGG No data
1040567865_1040567882 22 Left 1040567865 8:48582841-48582863 CCAGGGGGAAGGGTGGGGATCCC No data
Right 1040567882 8:48582886-48582908 CTTGTGGGTCTGGGAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040567882 Original CRISPR CTTGTGGGTCTGGGAGAGTC AGG Intergenic
No off target data available for this crispr