ID: 1040567888

View in Genome Browser
Species Human (GRCh38)
Location 8:48582908-48582930
Sequence GGAGGAGTCTGGTGAGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040567874_1040567888 23 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567888 8:48582908-48582930 GGAGGAGTCTGGTGAGGTCTGGG No data
1040567872_1040567888 24 Left 1040567872 8:48582861-48582883 CCCCAGGACGGTGGTTTTGGGGG No data
Right 1040567888 8:48582908-48582930 GGAGGAGTCTGGTGAGGTCTGGG No data
1040567881_1040567888 0 Left 1040567881 8:48582885-48582907 CCTTGTGGGTCTGGGAGAGTCAG No data
Right 1040567888 8:48582908-48582930 GGAGGAGTCTGGTGAGGTCTGGG No data
1040567880_1040567888 1 Left 1040567880 8:48582884-48582906 CCCTTGTGGGTCTGGGAGAGTCA No data
Right 1040567888 8:48582908-48582930 GGAGGAGTCTGGTGAGGTCTGGG No data
1040567875_1040567888 22 Left 1040567875 8:48582863-48582885 CCAGGACGGTGGTTTTGGGGGCC No data
Right 1040567888 8:48582908-48582930 GGAGGAGTCTGGTGAGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040567888 Original CRISPR GGAGGAGTCTGGTGAGGTCT GGG Intergenic
No off target data available for this crispr