ID: 1040568322

View in Genome Browser
Species Human (GRCh38)
Location 8:48586790-48586812
Sequence TTGGAGCAGCACCACCATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040568322_1040568329 18 Left 1040568322 8:48586790-48586812 CCGCCATGGTGGTGCTGCTCCAA No data
Right 1040568329 8:48586831-48586853 CTAAGAGGTCAGAGAGCCCAGGG No data
1040568322_1040568327 3 Left 1040568322 8:48586790-48586812 CCGCCATGGTGGTGCTGCTCCAA No data
Right 1040568327 8:48586816-48586838 AAAGGAGTGCATTGACTAAGAGG No data
1040568322_1040568328 17 Left 1040568322 8:48586790-48586812 CCGCCATGGTGGTGCTGCTCCAA No data
Right 1040568328 8:48586830-48586852 ACTAAGAGGTCAGAGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040568322 Original CRISPR TTGGAGCAGCACCACCATGG CGG (reversed) Intergenic
No off target data available for this crispr