ID: 1040568858

View in Genome Browser
Species Human (GRCh38)
Location 8:48590787-48590809
Sequence CTCATGACAGGTACCCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040568858_1040568863 14 Left 1040568858 8:48590787-48590809 CCTTACAGGGTACCTGTCATGAG No data
Right 1040568863 8:48590824-48590846 CTATGACACATTCATCCCAGGGG No data
1040568858_1040568862 13 Left 1040568858 8:48590787-48590809 CCTTACAGGGTACCTGTCATGAG No data
Right 1040568862 8:48590823-48590845 TCTATGACACATTCATCCCAGGG No data
1040568858_1040568865 27 Left 1040568858 8:48590787-48590809 CCTTACAGGGTACCTGTCATGAG No data
Right 1040568865 8:48590837-48590859 ATCCCAGGGGGTCTTTTCTATGG No data
1040568858_1040568861 12 Left 1040568858 8:48590787-48590809 CCTTACAGGGTACCTGTCATGAG No data
Right 1040568861 8:48590822-48590844 CTCTATGACACATTCATCCCAGG No data
1040568858_1040568864 15 Left 1040568858 8:48590787-48590809 CCTTACAGGGTACCTGTCATGAG No data
Right 1040568864 8:48590825-48590847 TATGACACATTCATCCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040568858 Original CRISPR CTCATGACAGGTACCCTGTA AGG (reversed) Intergenic
No off target data available for this crispr