ID: 1040571083

View in Genome Browser
Species Human (GRCh38)
Location 8:48611467-48611489
Sequence TTCGCCCTCGGTTAGATACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040571083_1040571085 15 Left 1040571083 8:48611467-48611489 CCGTGTATCTAACCGAGGGCGAA No data
Right 1040571085 8:48611505-48611527 ACACCTATAAGCCTGAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040571083 Original CRISPR TTCGCCCTCGGTTAGATACA CGG (reversed) Intergenic
No off target data available for this crispr