ID: 1040578227

View in Genome Browser
Species Human (GRCh38)
Location 8:48673287-48673309
Sequence CATTATTTGCAACTTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040578223_1040578227 30 Left 1040578223 8:48673234-48673256 CCACATAGTTCTCCAGCAGTGTC No data
Right 1040578227 8:48673287-48673309 CATTATTTGCAACTTTTTGTTGG No data
1040578224_1040578227 18 Left 1040578224 8:48673246-48673268 CCAGCAGTGTCAGTGTGCAGACA No data
Right 1040578227 8:48673287-48673309 CATTATTTGCAACTTTTTGTTGG No data
1040578225_1040578227 -8 Left 1040578225 8:48673272-48673294 CCACTGAGTGACCAGCATTATTT No data
Right 1040578227 8:48673287-48673309 CATTATTTGCAACTTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040578227 Original CRISPR CATTATTTGCAACTTTTTGT TGG Intergenic
No off target data available for this crispr