ID: 1040578269

View in Genome Browser
Species Human (GRCh38)
Location 8:48673629-48673651
Sequence GATGAGAAACCCAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040578269_1040578271 2 Left 1040578269 8:48673629-48673651 CCATCCACATTGGGTTTCTCATC No data
Right 1040578271 8:48673654-48673676 AAACCCCAACAGCACTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040578269 Original CRISPR GATGAGAAACCCAATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr