ID: 1040579521

View in Genome Browser
Species Human (GRCh38)
Location 8:48685909-48685931
Sequence GCAGCTGGTGATAGTGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040579521_1040579527 28 Left 1040579521 8:48685909-48685931 CCTGGTTCACTATCACCAGCTGC No data
Right 1040579527 8:48685960-48685982 TTTTCTATGTGTAAGAGATCAGG No data
1040579521_1040579523 -4 Left 1040579521 8:48685909-48685931 CCTGGTTCACTATCACCAGCTGC No data
Right 1040579523 8:48685928-48685950 CTGCTGTGCCCCTCAAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040579521 Original CRISPR GCAGCTGGTGATAGTGAACC AGG (reversed) Intergenic
No off target data available for this crispr