ID: 1040581485

View in Genome Browser
Species Human (GRCh38)
Location 8:48702160-48702182
Sequence ACTTCTTGGCAGAGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040581474_1040581485 22 Left 1040581474 8:48702115-48702137 CCCAGGCTGTAACAGATGCCTGG No data
Right 1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG No data
1040581479_1040581485 4 Left 1040581479 8:48702133-48702155 CCTGGACAACACACTCAGGGTGG No data
Right 1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG No data
1040581476_1040581485 21 Left 1040581476 8:48702116-48702138 CCAGGCTGTAACAGATGCCTGGA No data
Right 1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040581485 Original CRISPR ACTTCTTGGCAGAGGCTGGA AGG Intergenic
No off target data available for this crispr