ID: 1040586693

View in Genome Browser
Species Human (GRCh38)
Location 8:48750121-48750143
Sequence GACTCAGATCTGCCTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040586693_1040586700 7 Left 1040586693 8:48750121-48750143 CCAGGCAGAGGCAGATCTGAGTC No data
Right 1040586700 8:48750151-48750173 GGGCAATGACTAGTGTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040586693 Original CRISPR GACTCAGATCTGCCTCTGCC TGG (reversed) Intergenic
No off target data available for this crispr