ID: 1040590113

View in Genome Browser
Species Human (GRCh38)
Location 8:48783848-48783870
Sequence CACACTAGGACAGCCCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040590105_1040590113 26 Left 1040590105 8:48783799-48783821 CCTGAGCGTGGCTGCCAGCAGCT No data
Right 1040590113 8:48783848-48783870 CACACTAGGACAGCCCGGAGGGG No data
1040590106_1040590113 12 Left 1040590106 8:48783813-48783835 CCAGCAGCTCCACTGTCTCACTC No data
Right 1040590113 8:48783848-48783870 CACACTAGGACAGCCCGGAGGGG No data
1040590107_1040590113 3 Left 1040590107 8:48783822-48783844 CCACTGTCTCACTCTGTAGACCA No data
Right 1040590113 8:48783848-48783870 CACACTAGGACAGCCCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040590113 Original CRISPR CACACTAGGACAGCCCGGAG GGG Intergenic
No off target data available for this crispr