ID: 1040596838

View in Genome Browser
Species Human (GRCh38)
Location 8:48846818-48846840
Sequence CAGCTGCCTGCACTTGGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040596826_1040596838 19 Left 1040596826 8:48846776-48846798 CCATCTCCTCTCAGCCTAGCCCT No data
Right 1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG No data
1040596832_1040596838 0 Left 1040596832 8:48846795-48846817 CCCTGCTCAGTGGGGAGAGCTGG No data
Right 1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG No data
1040596834_1040596838 -1 Left 1040596834 8:48846796-48846818 CCTGCTCAGTGGGGAGAGCTGGC No data
Right 1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG No data
1040596827_1040596838 13 Left 1040596827 8:48846782-48846804 CCTCTCAGCCTAGCCCTGCTCAG No data
Right 1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG No data
1040596831_1040596838 5 Left 1040596831 8:48846790-48846812 CCTAGCCCTGCTCAGTGGGGAGA No data
Right 1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG No data
1040596824_1040596838 25 Left 1040596824 8:48846770-48846792 CCCTATCCATCTCCTCTCAGCCT No data
Right 1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG No data
1040596825_1040596838 24 Left 1040596825 8:48846771-48846793 CCTATCCATCTCCTCTCAGCCTA No data
Right 1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040596838 Original CRISPR CAGCTGCCTGCACTTGGTCG GGG Intergenic
No off target data available for this crispr