ID: 1040599329

View in Genome Browser
Species Human (GRCh38)
Location 8:48869211-48869233
Sequence CAGTGGACGGGGAAGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040599320_1040599329 -3 Left 1040599320 8:48869191-48869213 CCAGATTCCAGTGGCACCAGCAG No data
Right 1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG No data
1040599322_1040599329 -10 Left 1040599322 8:48869198-48869220 CCAGTGGCACCAGCAGTGGACGG No data
Right 1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG No data
1040599319_1040599329 5 Left 1040599319 8:48869183-48869205 CCAGAGCACCAGATTCCAGTGGC No data
Right 1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG No data
1040599317_1040599329 21 Left 1040599317 8:48869167-48869189 CCTTATTTGCAGTTGTCCAGAGC No data
Right 1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040599329 Original CRISPR CAGTGGACGGGGAAGTGGGA AGG Intergenic
No off target data available for this crispr