ID: 1040600465

View in Genome Browser
Species Human (GRCh38)
Location 8:48878788-48878810
Sequence GAGGCTAGGTCTTTAGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040600459_1040600465 22 Left 1040600459 8:48878743-48878765 CCTGCAGGTGTGGACTTTCATCT No data
Right 1040600465 8:48878788-48878810 GAGGCTAGGTCTTTAGGACCAGG No data
1040600458_1040600465 26 Left 1040600458 8:48878739-48878761 CCGTCCTGCAGGTGTGGACTTTC No data
Right 1040600465 8:48878788-48878810 GAGGCTAGGTCTTTAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040600465 Original CRISPR GAGGCTAGGTCTTTAGGACC AGG Intergenic
No off target data available for this crispr