ID: 1040601015

View in Genome Browser
Species Human (GRCh38)
Location 8:48883849-48883871
Sequence GTTTTCCACTGGAGCTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040601004_1040601015 27 Left 1040601004 8:48883799-48883821 CCGAGAAAATACAGAGTTGGGGG No data
Right 1040601015 8:48883849-48883871 GTTTTCCACTGGAGCTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040601015 Original CRISPR GTTTTCCACTGGAGCTTGGC TGG Intergenic
No off target data available for this crispr