ID: 1040601024

View in Genome Browser
Species Human (GRCh38)
Location 8:48883922-48883944
Sequence GTCTTTCTGGCCACAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040601024_1040601030 15 Left 1040601024 8:48883922-48883944 CCTGGCTCTGTGGCCAGAAAGAC No data
Right 1040601030 8:48883960-48883982 ATTATTTTTGTCTGTCTTGTTGG No data
1040601024_1040601033 25 Left 1040601024 8:48883922-48883944 CCTGGCTCTGTGGCCAGAAAGAC No data
Right 1040601033 8:48883970-48883992 TCTGTCTTGTTGGGAGCTCTGGG No data
1040601024_1040601031 16 Left 1040601024 8:48883922-48883944 CCTGGCTCTGTGGCCAGAAAGAC No data
Right 1040601031 8:48883961-48883983 TTATTTTTGTCTGTCTTGTTGGG No data
1040601024_1040601032 24 Left 1040601024 8:48883922-48883944 CCTGGCTCTGTGGCCAGAAAGAC No data
Right 1040601032 8:48883969-48883991 GTCTGTCTTGTTGGGAGCTCTGG No data
1040601024_1040601027 -9 Left 1040601024 8:48883922-48883944 CCTGGCTCTGTGGCCAGAAAGAC No data
Right 1040601027 8:48883936-48883958 CAGAAAGACCAGGCTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040601024 Original CRISPR GTCTTTCTGGCCACAGAGCC AGG (reversed) Intergenic