ID: 1040601026

View in Genome Browser
Species Human (GRCh38)
Location 8:48883935-48883957
Sequence CAGGAAAAGCCTGGTCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040601026_1040601033 12 Left 1040601026 8:48883935-48883957 CCAGAAAGACCAGGCTTTTCCTG No data
Right 1040601033 8:48883970-48883992 TCTGTCTTGTTGGGAGCTCTGGG No data
1040601026_1040601031 3 Left 1040601026 8:48883935-48883957 CCAGAAAGACCAGGCTTTTCCTG No data
Right 1040601031 8:48883961-48883983 TTATTTTTGTCTGTCTTGTTGGG No data
1040601026_1040601032 11 Left 1040601026 8:48883935-48883957 CCAGAAAGACCAGGCTTTTCCTG No data
Right 1040601032 8:48883969-48883991 GTCTGTCTTGTTGGGAGCTCTGG No data
1040601026_1040601034 18 Left 1040601026 8:48883935-48883957 CCAGAAAGACCAGGCTTTTCCTG No data
Right 1040601034 8:48883976-48883998 TTGTTGGGAGCTCTGGGTTGTGG No data
1040601026_1040601030 2 Left 1040601026 8:48883935-48883957 CCAGAAAGACCAGGCTTTTCCTG No data
Right 1040601030 8:48883960-48883982 ATTATTTTTGTCTGTCTTGTTGG No data
1040601026_1040601035 19 Left 1040601026 8:48883935-48883957 CCAGAAAGACCAGGCTTTTCCTG No data
Right 1040601035 8:48883977-48883999 TGTTGGGAGCTCTGGGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040601026 Original CRISPR CAGGAAAAGCCTGGTCTTTC TGG (reversed) Intergenic