ID: 1040601029

View in Genome Browser
Species Human (GRCh38)
Location 8:48883954-48883976
Sequence AGACAGACAAAAATAATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040601029_1040601035 0 Left 1040601029 8:48883954-48883976 CCTGGAATTATTTTTGTCTGTCT No data
Right 1040601035 8:48883977-48883999 TGTTGGGAGCTCTGGGTTGTGGG No data
1040601029_1040601032 -8 Left 1040601029 8:48883954-48883976 CCTGGAATTATTTTTGTCTGTCT No data
Right 1040601032 8:48883969-48883991 GTCTGTCTTGTTGGGAGCTCTGG No data
1040601029_1040601034 -1 Left 1040601029 8:48883954-48883976 CCTGGAATTATTTTTGTCTGTCT No data
Right 1040601034 8:48883976-48883998 TTGTTGGGAGCTCTGGGTTGTGG No data
1040601029_1040601036 22 Left 1040601029 8:48883954-48883976 CCTGGAATTATTTTTGTCTGTCT No data
Right 1040601036 8:48883999-48884021 GCTTCTAGAGCGTCCTGTCTAGG No data
1040601029_1040601037 30 Left 1040601029 8:48883954-48883976 CCTGGAATTATTTTTGTCTGTCT No data
Right 1040601037 8:48884007-48884029 AGCGTCCTGTCTAGGACATATGG No data
1040601029_1040601033 -7 Left 1040601029 8:48883954-48883976 CCTGGAATTATTTTTGTCTGTCT No data
Right 1040601033 8:48883970-48883992 TCTGTCTTGTTGGGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040601029 Original CRISPR AGACAGACAAAAATAATTCC AGG (reversed) Intergenic