ID: 1040601033

View in Genome Browser
Species Human (GRCh38)
Location 8:48883970-48883992
Sequence TCTGTCTTGTTGGGAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040601029_1040601033 -7 Left 1040601029 8:48883954-48883976 CCTGGAATTATTTTTGTCTGTCT No data
Right 1040601033 8:48883970-48883992 TCTGTCTTGTTGGGAGCTCTGGG No data
1040601028_1040601033 3 Left 1040601028 8:48883944-48883966 CCAGGCTTTTCCTGGAATTATTT No data
Right 1040601033 8:48883970-48883992 TCTGTCTTGTTGGGAGCTCTGGG No data
1040601024_1040601033 25 Left 1040601024 8:48883922-48883944 CCTGGCTCTGTGGCCAGAAAGAC No data
Right 1040601033 8:48883970-48883992 TCTGTCTTGTTGGGAGCTCTGGG No data
1040601026_1040601033 12 Left 1040601026 8:48883935-48883957 CCAGAAAGACCAGGCTTTTCCTG No data
Right 1040601033 8:48883970-48883992 TCTGTCTTGTTGGGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040601033 Original CRISPR TCTGTCTTGTTGGGAGCTCT GGG Intergenic