ID: 1040601935

View in Genome Browser
Species Human (GRCh38)
Location 8:48893425-48893447
Sequence GGCTGGTATTCCTGATGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040601935_1040601940 14 Left 1040601935 8:48893425-48893447 CCCAGACATCAGGAATACCAGCC No data
Right 1040601940 8:48893462-48893484 ACAACATATTACAGATGTGCTGG No data
1040601935_1040601941 17 Left 1040601935 8:48893425-48893447 CCCAGACATCAGGAATACCAGCC No data
Right 1040601941 8:48893465-48893487 ACATATTACAGATGTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040601935 Original CRISPR GGCTGGTATTCCTGATGTCT GGG (reversed) Intergenic
No off target data available for this crispr