ID: 1040602435

View in Genome Browser
Species Human (GRCh38)
Location 8:48897741-48897763
Sequence CAGTGATTCTGGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040602435_1040602448 7 Left 1040602435 8:48897741-48897763 CCTGCCTCCCTCCAGAATCACTG No data
Right 1040602448 8:48897771-48897793 GCCCTCTCAGGCTGGCTGCCGGG No data
1040602435_1040602447 6 Left 1040602435 8:48897741-48897763 CCTGCCTCCCTCCAGAATCACTG No data
Right 1040602447 8:48897770-48897792 GGCCCTCTCAGGCTGGCTGCCGG No data
1040602435_1040602451 17 Left 1040602435 8:48897741-48897763 CCTGCCTCCCTCCAGAATCACTG No data
Right 1040602451 8:48897781-48897803 GCTGGCTGCCGGGATTGCCTTGG No data
1040602435_1040602453 23 Left 1040602435 8:48897741-48897763 CCTGCCTCCCTCCAGAATCACTG No data
Right 1040602453 8:48897787-48897809 TGCCGGGATTGCCTTGGGAGAGG No data
1040602435_1040602445 -5 Left 1040602435 8:48897741-48897763 CCTGCCTCCCTCCAGAATCACTG No data
Right 1040602445 8:48897759-48897781 CACTGGGATGGGGCCCTCTCAGG No data
1040602435_1040602452 18 Left 1040602435 8:48897741-48897763 CCTGCCTCCCTCCAGAATCACTG No data
Right 1040602452 8:48897782-48897804 CTGGCTGCCGGGATTGCCTTGGG No data
1040602435_1040602454 24 Left 1040602435 8:48897741-48897763 CCTGCCTCCCTCCAGAATCACTG No data
Right 1040602454 8:48897788-48897810 GCCGGGATTGCCTTGGGAGAGGG No data
1040602435_1040602446 -1 Left 1040602435 8:48897741-48897763 CCTGCCTCCCTCCAGAATCACTG No data
Right 1040602446 8:48897763-48897785 GGGATGGGGCCCTCTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040602435 Original CRISPR CAGTGATTCTGGAGGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr