ID: 1040604650

View in Genome Browser
Species Human (GRCh38)
Location 8:48919927-48919949
Sequence GCAAGGCGTTTTCCAGACCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040604650_1040604654 9 Left 1040604650 8:48919927-48919949 CCAGGGTCTGGAAAACGCCTTGC 0: 1
1: 0
2: 1
3: 12
4: 100
Right 1040604654 8:48919959-48919981 TGCAAACACAAGGTAATGTGTGG 0: 1
1: 0
2: 1
3: 16
4: 209
1040604650_1040604653 -1 Left 1040604650 8:48919927-48919949 CCAGGGTCTGGAAAACGCCTTGC 0: 1
1: 0
2: 1
3: 12
4: 100
Right 1040604653 8:48919949-48919971 CCGCAGATCTTGCAAACACAAGG 0: 1
1: 0
2: 0
3: 5
4: 93
1040604650_1040604656 30 Left 1040604650 8:48919927-48919949 CCAGGGTCTGGAAAACGCCTTGC 0: 1
1: 0
2: 1
3: 12
4: 100
Right 1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 44
1040604650_1040604655 10 Left 1040604650 8:48919927-48919949 CCAGGGTCTGGAAAACGCCTTGC 0: 1
1: 0
2: 1
3: 12
4: 100
Right 1040604655 8:48919960-48919982 GCAAACACAAGGTAATGTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040604650 Original CRISPR GCAAGGCGTTTTCCAGACCC TGG (reversed) Exonic
900482019 1:2904098-2904120 CCAAGGTGGTTTCCAGTCCCGGG - Intergenic
900542351 1:3209498-3209520 GCGAGGCCTATTCCACACCCAGG - Intronic
902138512 1:14332146-14332168 GCCAGGCAGTTTCCCGACCCTGG + Intergenic
903856275 1:26339321-26339343 GCAGGGGCTTCTCCAGACCCTGG + Exonic
904539585 1:31223924-31223946 GCAATGCCTGTTCCAGTCCCTGG + Intronic
906225712 1:44119451-44119473 GGTAGGCTTTTCCCAGACCCTGG + Intronic
917268199 1:173243953-173243975 GCAAGGAGTTTTCAAGAACAGGG + Intergenic
917924578 1:179778543-179778565 GGAAGACGTTTTACAGACCATGG + Intronic
919179653 1:194063942-194063964 GGAAGACATTTTACAGACCCAGG + Intergenic
919640974 1:200042878-200042900 GCAAGGCGGTTACCCGATCCCGG + Intronic
924903212 1:248424259-248424281 GCTAAGCCTTTTCCAGATCCAGG - Intergenic
924903347 1:248425868-248425890 GCTAGGCCTTTTCCAGATCCAGG + Intergenic
924924515 1:248665936-248665958 GCTAGGCCTTTTCCAGATCTAGG - Intergenic
924924654 1:248667538-248667560 GCTAAGCCTTTTCCAGATCCAGG + Intergenic
1065479322 10:26176616-26176638 GTAAGGCGTTTCCCAGCCCCCGG + Intronic
1066255238 10:33672301-33672323 GCCAGGTGTTTTCAACACCCTGG - Intergenic
1071287085 10:84159032-84159054 ACAAGGAGCTTTCCAGATCCGGG + Intergenic
1076697112 10:132252191-132252213 GCCAGGCCCATTCCAGACCCAGG + Intronic
1076816211 10:132916081-132916103 ACAAGGCGTTTTCGAGGCCAAGG + Intronic
1076840561 10:133043300-133043322 GCAAGGGGGTGTCCAGACACAGG - Intergenic
1079946824 11:26753733-26753755 TGACGACGTTTTCCAGACCCCGG - Intergenic
1084494319 11:69495288-69495310 GCATGGCTTCTTCCAGCCCCAGG - Intergenic
1100713686 12:97283712-97283734 GCAAGGTGGTTACCAGGCCCAGG - Intergenic
1101045579 12:100802149-100802171 CCAGGGGGTTTTCCACACCCTGG - Intronic
1101749936 12:107575280-107575302 GCAAGGCCTTTTCCTGCACCTGG + Intronic
1104758356 12:131282711-131282733 GAAAGGCTGTTTCCAGACTCAGG + Intergenic
1108613699 13:52109548-52109570 CCAAGGCTTTTTCCTGATCCAGG + Intronic
1110437482 13:75491457-75491479 GCAAGGATGTTTCCAGTCCCTGG - Intergenic
1113052541 13:106229947-106229969 CCAAGACGGTTTCCAGAGCCTGG - Intergenic
1113951689 13:114075429-114075451 GGGAGGCGTTGTCCAGACCCTGG - Intronic
1114401838 14:22417340-22417362 CCCAGGGGTTTGCCAGACCCAGG - Intergenic
1117723119 14:58646396-58646418 GCAAGCCGTTCTCCAGCCCCTGG - Exonic
1118612547 14:67552878-67552900 GCAAGGCACTTTTCAGAGCCTGG - Intronic
1122004860 14:98694256-98694278 TCAAACCTTTTTCCAGACCCTGG - Intergenic
1122297687 14:100714475-100714497 GCCAGGCCTTTTCAATACCCAGG - Intergenic
1124911536 15:33926146-33926168 GCACTGTGTTTTCCAGACTCTGG - Intronic
1131679957 15:94710819-94710841 GCAAGGTGTTTTCAAGAACAAGG - Intergenic
1135171613 16:20189094-20189116 GAAAGGTGTTTTCCAGAGGCTGG + Intergenic
1137619951 16:49869615-49869637 ACAAGTCGTTTTCCAGCCTCAGG - Intergenic
1141603017 16:85137594-85137616 GGGAGGCGCTTCCCAGACCCAGG - Intergenic
1141895437 16:86955983-86956005 GCAAGTGGGTTTCCAGATCCCGG + Intergenic
1142183083 16:88681125-88681147 GCAAGGCCTTCTCCAGGCCCTGG - Exonic
1142200133 16:88757210-88757232 GCATCGCGTCTTCCAGCCCCCGG - Intronic
1142287995 16:89179257-89179279 GCAAGGCGGCTTCCACACACGGG - Intronic
1144035540 17:11362011-11362033 CCGAGGGGTTTTCCAGGCCCAGG + Intronic
1144637225 17:16918073-16918095 ACATAGCATTTTCCAGACCCAGG + Intergenic
1144654378 17:17025861-17025883 GCACTGCGTGTGCCAGACCCTGG - Intergenic
1146944303 17:36863546-36863568 GCAAGTCGTTTTCCTGCTCCGGG - Intergenic
1148371622 17:47103969-47103991 GAAAGGAGCTTCCCAGACCCTGG - Intergenic
1158169408 18:54579478-54579500 GCATCACGTTTTCCATACCCAGG + Intergenic
1160357745 18:78242936-78242958 GCCAGGCGATCTCCAGCCCCTGG + Intergenic
1160417865 18:78724169-78724191 GTAAGGGGTTGTGCAGACCCGGG + Intergenic
1162332152 19:10036995-10037017 GCAAGGAGCTTTGCACACCCAGG - Intergenic
1163799528 19:19356211-19356233 TCAAGGCAATTTCCAGAGCCCGG + Exonic
1166298670 19:41902221-41902243 GCACAGCATCTTCCAGACCCTGG + Intronic
1167776352 19:51560199-51560221 AGAAGGCGTTTTACAGACCCTGG - Intergenic
943703970 2:191015463-191015485 TCAAGGGGTTTTCCAAACTCAGG - Intronic
943747778 2:191480123-191480145 GAAAGGCAATTTCCATACCCAGG - Intergenic
945435064 2:209809342-209809364 GGAAGGCCTTCTCCAGACCCTGG + Intronic
948598359 2:239094888-239094910 GCCAGGTGTTTTCCATACGCAGG - Intronic
1170434734 20:16314814-16314836 GCAAAGGGTTTTCCGGAACCTGG + Intronic
1170947059 20:20900787-20900809 GCAAGGGCTTGTCCAGACCCTGG + Intergenic
1175516224 20:59571949-59571971 GCAAGGCGTCTCCCACAGCCCGG + Intergenic
1175944803 20:62553725-62553747 GCAAGGAGTTGTCCAGCTCCCGG + Intronic
1176025914 20:62985591-62985613 GCCAGGCCTTTTCCAGACGCTGG - Intergenic
1181690480 22:24556118-24556140 GCAAGTCTTTCTCCAGCCCCTGG - Intronic
1182086128 22:27562459-27562481 CCAAGGCATATTCCAGAGCCTGG - Intergenic
1182936006 22:34222239-34222261 GCAAGGCACTGTCCAAACCCTGG + Intergenic
1183667742 22:39255073-39255095 CCAAGGGGGTTTCCAGGCCCAGG + Intergenic
950449513 3:13057793-13057815 GCAGGGAGTTTTCCAGACTCAGG - Intronic
952212066 3:31238046-31238068 GAAAGTCGTTTTCCACACACTGG + Intergenic
954434856 3:50490527-50490549 GCAAGGAGTTTTCCCAGCCCAGG - Intronic
955032438 3:55233935-55233957 TCAAGGCTTTTCCCAGTCCCCGG - Intergenic
958161308 3:89819098-89819120 GCAGGGATTTTTCCAGGCCCCGG + Intergenic
961316083 3:126036519-126036541 GAAAGGCAGTTTCCAGATCCTGG - Intronic
963753364 3:149206310-149206332 GCAAGCCTTTTTCCAGGTCCAGG - Exonic
969090592 4:4691277-4691299 GCAAGGCCTTTCTCAGACCTGGG - Intergenic
969455564 4:7297938-7297960 GCAAGGCGGATACCAGCCCCAGG - Intronic
970037355 4:11752973-11752995 GCAGGGATTTTCCCAGACCCAGG - Intergenic
971590234 4:28458217-28458239 GCAAGGATTTTTCCAGTGCCTGG + Intergenic
972047575 4:34686822-34686844 GCAAAGAGATTTCCAGAACCAGG - Intergenic
972059711 4:34854437-34854459 TCAAGGCTTTCTCCAGAGCCAGG + Intergenic
988857813 5:35246541-35246563 GGAAGGCATTTTCCAGCCTCAGG + Intergenic
990504828 5:56433863-56433885 GCAAGACTTCTCCCAGACCCAGG + Intergenic
995388782 5:111616237-111616259 GCAGGCATTTTTCCAGACCCAGG - Intergenic
996731845 5:126724623-126724645 GCAAAGCATTTTCAAGGCCCTGG + Intergenic
996762728 5:127002672-127002694 ACAAGCCATTTTCCAGAGCCTGG + Intronic
998968724 5:147568457-147568479 ACAAGGCGATTAGCAGACCCAGG + Intergenic
999407384 5:151318860-151318882 GCAGGACGTTTTACAGACCTGGG + Intronic
1002033342 5:176447242-176447264 GAAAAGCGTGTACCAGACCCAGG + Intergenic
1003869045 6:10387439-10387461 GCAAGGGATTTTCCAGTCCCAGG + Intergenic
1003873077 6:10416862-10416884 GCAAGGGGCCTTACAGACCCAGG + Intronic
1006835877 6:36998581-36998603 GCAAGGCTTGTGCCAGGCCCTGG - Intergenic
1010212060 6:73369834-73369856 GCAAGACCTCTTCCAGACCCAGG + Intronic
1013235260 6:108192862-108192884 GCAAGGCTTGTTTCAGATCCTGG + Intergenic
1019078824 6:169413405-169413427 CCAAGGTGATTTCCAGCCCCAGG + Intergenic
1019642455 7:2111354-2111376 GCAAGGAGCTTTCGAGACCGTGG + Intronic
1021910886 7:25385217-25385239 TCAAGGAATTTTCCAGCCCCTGG + Intergenic
1025722075 7:64026102-64026124 TGAAGGCTTTATCCAGACCCAGG - Intergenic
1026301976 7:69105995-69106017 TCCAGGCCTTTTCCTGACCCAGG + Intergenic
1037927431 8:22855059-22855081 GAAAGGCGTTTTTTAAACCCTGG + Intronic
1038902935 8:31864496-31864518 GAAAGGAGTTTGCCAGGCCCAGG + Intronic
1040105416 8:43538824-43538846 GCCAGGTGTGTTCCAGGCCCTGG - Intergenic
1040604650 8:48919927-48919949 GCAAGGCGTTTTCCAGACCCTGG - Exonic
1047208525 8:122822070-122822092 GTAAGGGGACTTCCAGACCCTGG + Intronic
1048301284 8:133253087-133253109 CCAAGGGGTTTTCCAGACCCTGG + Intronic
1049450596 8:142659461-142659483 GCACGGCCATTTCCACACCCAGG - Intronic
1051147264 9:14040781-14040803 CCATGGCGGCTTCCAGACCCTGG - Intergenic
1055900176 9:81225010-81225032 GCAAGGCTTTCATCAGACCCTGG - Intergenic
1187488426 X:19726256-19726278 GGAAGGCGTCTGACAGACCCAGG + Intronic
1188364212 X:29294725-29294747 GCAAGGCATTTTCTAGATCAGGG - Intronic
1190463105 X:50698543-50698565 ACTAGCCCTTTTCCAGACCCAGG + Intronic
1191167358 X:57404779-57404801 GAAAGTCGTGGTCCAGACCCAGG + Intronic
1198102999 X:133438052-133438074 GCAAAGCCTTTTCAAGAACCTGG + Intergenic