ID: 1040604651

View in Genome Browser
Species Human (GRCh38)
Location 8:48919944-48919966
Sequence TGTTTGCAAGATCTGCGGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040604651_1040604657 14 Left 1040604651 8:48919944-48919966 CCTTGCCGCAGATCTTGCAAACA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1040604657 8:48919981-48920003 GGTCCGAATATGCATCTTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 54
1040604651_1040604656 13 Left 1040604651 8:48919944-48919966 CCTTGCCGCAGATCTTGCAAACA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 44
1040604651_1040604654 -8 Left 1040604651 8:48919944-48919966 CCTTGCCGCAGATCTTGCAAACA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1040604654 8:48919959-48919981 TGCAAACACAAGGTAATGTGTGG 0: 1
1: 0
2: 1
3: 16
4: 209
1040604651_1040604659 22 Left 1040604651 8:48919944-48919966 CCTTGCCGCAGATCTTGCAAACA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1040604659 8:48919989-48920011 TATGCATCTTCAGGGCGCCCAGG 0: 1
1: 0
2: 1
3: 3
4: 75
1040604651_1040604655 -7 Left 1040604651 8:48919944-48919966 CCTTGCCGCAGATCTTGCAAACA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1040604655 8:48919960-48919982 GCAAACACAAGGTAATGTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040604651 Original CRISPR TGTTTGCAAGATCTGCGGCA AGG (reversed) Exonic
904093978 1:27963498-27963520 TGCGTGCAGGAGCTGCGGCAGGG + Exonic
904568445 1:31442672-31442694 TGTTTGCAAGTCCTGACGCAGGG + Intergenic
909091203 1:71228206-71228228 TGTCTGCAAGATAGGCAGCATGG + Intergenic
909361509 1:74765057-74765079 GGTTTGGAAGATCTGCGGCAGGG - Exonic
915002923 1:152609843-152609865 TGTTGGCAGGTTCTGCGGCAGGG + Intergenic
916452573 1:164935105-164935127 TATTTGCAAGAAGTGGGGCAGGG + Intergenic
916931607 1:169584092-169584114 TGTATTAAAGATCTGGGGCAGGG - Intronic
919430032 1:197481188-197481210 TGTTTGCAGGCTTTGGGGCATGG + Intergenic
921430019 1:215054622-215054644 AGTTTGCAAGTTCTGTGTCAAGG + Intronic
921480730 1:215661906-215661928 TGTTTGCAGGATCTGAGTGATGG - Intronic
1063781374 10:9329139-9329161 TGTTTTAAAGATGTGTGGCATGG - Intergenic
1064232277 10:13539507-13539529 TGTTTCCAAGGTCTTCGGAATGG - Intergenic
1066135520 10:32441825-32441847 AGTTTGCAAAAGCTGCAGCAGGG - Intergenic
1070556006 10:77528155-77528177 TGGGTGCAAGCTCTGAGGCATGG - Intronic
1070994823 10:80768801-80768823 TGTTTGCAGGATATGTGACAAGG - Intergenic
1072910403 10:99496024-99496046 AGTTTGCAACCTCTGGGGCAAGG - Intergenic
1074999830 10:118787493-118787515 TGTTTGCAAGAACTCTGCCATGG - Intergenic
1075130407 10:119733377-119733399 TGTTTGGAAGATCTGCAGTTTGG + Intronic
1075302163 10:121334570-121334592 TGTTTTCAAGTTGTGGGGCAAGG + Intergenic
1078882341 11:15464524-15464546 TGGTTGCAGGATCTGAGCCATGG - Intergenic
1100452756 12:94723050-94723072 TGTTTGCATGCTATGTGGCAAGG + Intergenic
1102730410 12:115104007-115104029 TGTTGCCAGGATCTGGGGCAGGG - Intergenic
1103402213 12:120650695-120650717 AGTTTCCAAGATCTGGGGCTGGG + Intronic
1106461756 13:29976704-29976726 TGTGAGCAAGATCAGAGGCAAGG + Intergenic
1110145241 13:72182722-72182744 TGTTTTCAAGATGTAGGGCAAGG + Intergenic
1111876472 13:93903410-93903432 TCTTTGAAAGTTCTGCAGCAAGG - Intronic
1112859259 13:103810071-103810093 TGTTTACAAGAACTGCTGGAAGG + Intergenic
1112991794 13:105522854-105522876 TGTTTGCAAGTTCTTCCTCATGG + Intergenic
1126173545 15:45714406-45714428 TTTTTCCAAGATCTGCTGCAGGG - Intergenic
1128692393 15:69734952-69734974 TGGCTGCAAGATCTGCGACTTGG + Intergenic
1144735076 17:17550961-17550983 TACATGCAAGATCTGCAGCAGGG - Intronic
1146916175 17:36679858-36679880 TGTTTGCAGGGTCTGGCGCAGGG + Intergenic
1148262782 17:46197854-46197876 TGTTTAGAAGGTCTGTGGCAGGG - Intronic
1156222267 18:35064433-35064455 TGTTTGCAAGGGGTGGGGCAGGG + Intronic
1163182631 19:15615195-15615217 TGTTTCCTAGATCTGGGGCCAGG + Intergenic
1165854826 19:38873385-38873407 TCTTTGCAGGATTTGGGGCAGGG + Intronic
1165969423 19:39613987-39614009 TGAAGGCAAGATCTGAGGCATGG + Intergenic
1167126027 19:47549267-47549289 CGTCTGCAAAATCTGCAGCAAGG - Exonic
931516313 2:63052336-63052358 TGATTGCGGGATCTGGGGCAGGG + Intronic
933657295 2:84899531-84899553 AGTTTGCAAACTCTGCCGCAGGG + Intronic
934494206 2:94783230-94783252 AGTTTGCAAAATCTGCAGCCTGG - Intergenic
934737045 2:96694914-96694936 TCTTTGCCACATTTGCGGCAGGG - Intergenic
935131838 2:100266437-100266459 AGGCTGCAAGATCTGGGGCAGGG - Intergenic
938299976 2:130203455-130203477 TGTTGGCCAGATCAGCTGCAGGG + Intergenic
938456738 2:131471034-131471056 TGTTGGCCAGATCAGCTGCAGGG - Intronic
942441763 2:176044201-176044223 GGTTTGCAAGATCTTTTGCAGGG - Intergenic
945533996 2:210989420-210989442 TGTTTGAAAAATTTGCAGCATGG + Intergenic
946426070 2:219597773-219597795 CGTTTGCATGATCTACGGCGCGG + Intergenic
946456869 2:219833598-219833620 TGTTTGCAAGCTGAGGGGCAAGG + Intergenic
1172113159 20:32559311-32559333 TGGATGCAAGACCTGAGGCAGGG - Intronic
1182977688 22:34638873-34638895 TGTTTGCAAGATTTGGACCATGG + Intergenic
952691766 3:36215537-36215559 TGTTTCCAAGATATGCAGAAAGG - Intergenic
952706040 3:36379371-36379393 TGTTTGCAAGAACAGCTTCATGG - Intergenic
955076424 3:55617829-55617851 TGTTTTTAAGATCTGGAGCAAGG + Intronic
957986800 3:87582367-87582389 AGTTTGCACCATTTGCGGCAGGG + Intergenic
961507416 3:127379191-127379213 TGTTTGCAGGCTGTGCGGCAGGG - Intergenic
961513283 3:127417503-127417525 TGTTTGCAGGAGCCGGGGCAGGG + Intergenic
972187930 4:36554456-36554478 TGTCTGCCAGTTCTGCTGCAAGG - Intergenic
978176855 4:105742507-105742529 TGGTTGCATCATCTGCGGAATGG + Intronic
981783734 4:148454722-148454744 TCTTCTCAAGATCTGGGGCAAGG - Intergenic
983623416 4:169783008-169783030 TGTCTGCAACATCCGGGGCAGGG + Intergenic
993295137 5:86128333-86128355 TGTCTTCAAGATTTTCGGCATGG + Intergenic
993590322 5:89787476-89787498 TGTTGGCAGGATCTGAGGAATGG - Intergenic
1002025164 5:176391964-176391986 TGTTTGCAAACTCTGCTGAAGGG + Intronic
1002596087 5:180324349-180324371 TGTTTGCATAATATGCAGCAAGG + Intronic
1006245906 6:32735601-32735623 AGTTTGCACCATTTGCGGCAGGG + Intergenic
1007159202 6:39775205-39775227 GGGTTGCAAGTTCTGAGGCAGGG - Intergenic
1009631224 6:66203130-66203152 TGGGTGCAAGATCTGGGCCATGG + Intergenic
1022891213 7:34701822-34701844 TGTTTTCAAGATGTGGGTCATGG - Intronic
1022903636 7:34834736-34834758 TCTTTGCTAGATCTGAGGCTGGG - Intronic
1027197384 7:76040025-76040047 TGATAGCAAGATCTAAGGCAAGG - Intronic
1029227191 7:99036782-99036804 TGTTTGCAAGATCTCTAGCAGGG - Intronic
1033339831 7:140483350-140483372 TGTTTCCTAGATCTGGGGAAGGG - Intergenic
1040604651 8:48919944-48919966 TGTTTGCAAGATCTGCGGCAAGG - Exonic
1041085813 8:54255327-54255349 TGTCTGCAAGACCTGCCACAAGG - Intergenic
1041844687 8:62314785-62314807 TGTTTTAAAAATCTGCTGCAAGG - Intronic
1045889705 8:107140899-107140921 TGTTTGAAAGCTCTGAGGCTTGG - Intergenic
1047889866 8:129295778-129295800 TTTTTGCAAGGTCTGTGTCATGG + Intergenic
1052193358 9:25683450-25683472 AGTTTGGAAGATTTGCGGCCTGG + Intergenic
1052403925 9:28034997-28035019 GGTTTGCAAGAGCTGTGGAATGG - Intronic
1057211820 9:93204666-93204688 TGTTTGCAGGCTCTGTGACACGG + Intronic
1059596410 9:115724931-115724953 TGATTGCAACATCTCCAGCAAGG + Intergenic
1062269781 9:135703125-135703147 TGTTTTCAAGAGCTGAGGGATGG - Intronic
1186009825 X:5116887-5116909 TGTTTGAAAGATCTGCATGAAGG + Intergenic
1187361284 X:18629939-18629961 GGTTTGCAAGATCTGCAGACAGG - Intronic
1192922839 X:75725052-75725074 TGTCTGCAAGCTGTGGGGCAAGG + Intergenic
1193068474 X:77282344-77282366 TGTTTGCAGTATTTGCTGCATGG - Intergenic
1195036387 X:100973866-100973888 TGTTTGTAAGATTGGGGGCAGGG + Intronic
1199811892 X:151358014-151358036 TGTTTACAAGATCTGCTCCTTGG + Intergenic
1199852445 X:151735371-151735393 CGTTTGCAATAGCTGCTGCAAGG - Intergenic
1201474115 Y:14362458-14362480 TGCTTGAAACATCTGTGGCAGGG - Intergenic