ID: 1040604652

View in Genome Browser
Species Human (GRCh38)
Location 8:48919949-48919971
Sequence CCTTGTGTTTGCAAGATCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040604652_1040604657 9 Left 1040604652 8:48919949-48919971 CCGCAGATCTTGCAAACACAAGG 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1040604657 8:48919981-48920003 GGTCCGAATATGCATCTTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 54
1040604652_1040604659 17 Left 1040604652 8:48919949-48919971 CCGCAGATCTTGCAAACACAAGG 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1040604659 8:48919989-48920011 TATGCATCTTCAGGGCGCCCAGG 0: 1
1: 0
2: 1
3: 3
4: 75
1040604652_1040604656 8 Left 1040604652 8:48919949-48919971 CCGCAGATCTTGCAAACACAAGG 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040604652 Original CRISPR CCTTGTGTTTGCAAGATCTG CGG (reversed) Exonic
903287522 1:22286076-22286098 CCTTGTGCTTCCAGCATCTGAGG + Intergenic
904452815 1:30627151-30627173 CCTTTTGTTTCCCAGATCTTGGG + Intergenic
905288730 1:36906820-36906842 CCTAGTGTTTGACAGATCAGTGG + Intronic
905955045 1:41985696-41985718 CCTCCTGTTTGTCAGATCTGGGG + Intronic
906801432 1:48740735-48740757 CCTTCTGTCTGCACGATCAGAGG - Intronic
907959626 1:59266644-59266666 GGTTGTGTTTGCATGATCTGAGG + Intergenic
909664552 1:78118709-78118731 CCTTGTGCTTTCAAGAGGTGTGG + Intronic
911397007 1:97322358-97322380 GCTTGTTTTTGCCAGCTCTGTGG + Intronic
912011180 1:104965428-104965450 CCTAGTGTGTTCAAGAACTGGGG + Intergenic
915957446 1:160233477-160233499 CCTTGTGTTTTTGAGATGTGTGG - Intronic
924101943 1:240612625-240612647 CCTTTTGTTTGCAGTAACTGAGG + Intergenic
924568971 1:245220739-245220761 CATTGTGTTTGGAAATTCTGTGG - Intronic
1064853800 10:19741848-19741870 CTTAATGTTTGTAAGATCTGGGG - Intronic
1065728508 10:28689986-28690008 CCTAGTGTTTGACAGATCAGTGG - Intergenic
1066329387 10:34403026-34403048 CATTGTGTTTGGAGAATCTGAGG - Intronic
1068722603 10:60262894-60262916 CCTGGTGTTTGAAAGAGATGAGG - Intronic
1070765568 10:79054199-79054221 CCTGCTGTGTGCAAGACCTGAGG - Intergenic
1071711369 10:88053136-88053158 CCTTCTACTTGCTAGATCTGTGG + Intergenic
1072747891 10:97954415-97954437 CGTTGTGATTGCTAGAGCTGGGG + Intronic
1073870371 10:107856164-107856186 CCTTGTCATTTCAAGAACTGTGG - Intergenic
1075825949 10:125357183-125357205 CCTTGTATTGGCAAGATGGGTGG - Intergenic
1077371970 11:2186581-2186603 CCCTGCGTTGGCAAGACCTGAGG - Intergenic
1078287378 11:9970820-9970842 CCCTGTCTTTGCTAGATATGGGG - Intronic
1079705269 11:23608135-23608157 CTCTGTGTTTCCAAAATCTGTGG - Intergenic
1083429454 11:62606458-62606480 CTTTGTGTTTGCCAGATCTCAGG - Intronic
1086766379 11:90700921-90700943 CCTTCTGTTTGAATTATCTGTGG - Intergenic
1091698876 12:2646868-2646890 CCTTGTGATTGCAGGGTGTGGGG - Intronic
1092793799 12:12091551-12091573 CCTTGTTTTTCCAGAATCTGTGG + Intronic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1105686516 13:22788329-22788351 CCATGTGTGTAGAAGATCTGTGG + Intergenic
1107035350 13:35896785-35896807 CCTTATGTTGGAATGATCTGAGG - Intronic
1107454991 13:40546581-40546603 CCTTGTGCTGGCAAGACCAGAGG + Intergenic
1108009213 13:45986861-45986883 CCTTGTGGTTACAAGATGTTTGG - Intronic
1108779043 13:53805268-53805290 GTTTGTGTTTGTAAGATATGAGG + Intergenic
1108900305 13:55395727-55395749 TCTTTTGTTTGAAAAATCTGTGG - Intergenic
1109057248 13:57566469-57566491 TGTTGTGTTTGCAAGGACTGTGG + Intergenic
1109234914 13:59804179-59804201 CTTTGTGTTTGGAACTTCTGGGG - Intronic
1110744879 13:79040305-79040327 CCTAATGTTTGCAACAACTGTGG + Intergenic
1111623918 13:90758931-90758953 TCTTGTATTTGAGAGATCTGGGG + Intergenic
1114364812 14:22014496-22014518 CCTTTTGTATGCAACATTTGTGG + Intergenic
1116803337 14:49466282-49466304 CCTTTTATTTGCAATATGTGTGG - Intergenic
1118436611 14:65776988-65777010 CCTTATTTTTACATGATCTGAGG + Intergenic
1119939203 14:78622741-78622763 CCATTTGTTGGCAAGATCTGTGG + Intronic
1123950177 15:25264168-25264190 CCTTGTGTTTGGTGAATCTGTGG + Intergenic
1131448264 15:92517453-92517475 CCCTGTGATTGCAAGATCACAGG + Intergenic
1132112685 15:99113956-99113978 CCTAGTGTTTGTATGTTCTGGGG + Intronic
1132475819 16:137497-137519 CCCTGTGCTTGCTAGAACTGGGG + Intronic
1133498353 16:6341517-6341539 CCTTTTGTTTTCAAGATATGGGG - Intronic
1133908306 16:10041504-10041526 ACTTGTGTTTTAAAGAACTGAGG - Intronic
1140299031 16:73738531-73738553 CATTGTGTTTGCTAGTTCTAAGG + Intergenic
1140733276 16:77875414-77875436 CCTTGTGTTTGCAAGTTTGCAGG - Intronic
1141334917 16:83145733-83145755 ACTTGTCATTGCAAGACCTGAGG + Intronic
1141772482 16:86099043-86099065 TCTTTTGTTTGCCAGATCTTAGG + Intergenic
1147222159 17:38941811-38941833 CGGTGTGTTGGCAACATCTGTGG - Intronic
1147969795 17:44213124-44213146 CCTTGAGTTTGCCATCTCTGAGG - Intronic
1148490271 17:48019006-48019028 CCTTGTGTTTGGAAGGTTGGAGG - Intergenic
1150219996 17:63490808-63490830 CCTACTGTTTGCAAGCTTTGAGG - Intronic
1150249255 17:63697239-63697261 CCTTGCCTTTTCAAGCTCTGCGG - Exonic
1153272847 18:3340575-3340597 CCTTGTTTGTGAAACATCTGGGG + Intergenic
1155018243 18:21868347-21868369 GTTTGTGTTTGCAAGATCTAAGG + Exonic
1155360352 18:24993437-24993459 TCCTGTGTTTGCAAGCTCTAAGG - Intergenic
1157310888 18:46552454-46552476 CCTTGTGTTTCCACCATCTTAGG + Intronic
1157948544 18:52008590-52008612 CCTTGTGTTTGCTAATTCTTGGG + Intergenic
1158726322 18:59976130-59976152 TTTTGTGTTTCCAAAATCTGAGG - Intergenic
1158950234 18:62487796-62487818 CCTTGTGTTTGGCAGCTCTGAGG - Intergenic
1159885939 18:73906962-73906984 TCTTGGCTTTGGAAGATCTGTGG - Intergenic
1162270444 19:9610381-9610403 CCCTTTGTATGCAAGATATGTGG - Exonic
1162280204 19:9690319-9690341 CCCTTTGTATGCAAGATATGTGG - Exonic
1162283988 19:9724129-9724151 CCCTTTGTATGCAAGATATGTGG - Intergenic
1163460273 19:17433258-17433280 GCTTGTGTTTGCGAGGCCTGTGG + Intronic
1163819538 19:19488059-19488081 CCTAGTGTGTGCAAGACTTGGGG + Intronic
1165970580 19:39625436-39625458 CCCTGTGCTTGCAGGATGTGAGG + Intergenic
1165975976 19:39677057-39677079 CCCTGTGCTTGCAGGATGTGAGG - Intergenic
1166256734 19:41611868-41611890 CATTATGTTTGCTAGACCTGTGG + Intronic
1166636278 19:44454332-44454354 CGTTTTGTTTTCAAGTTCTGGGG + Intergenic
1167457410 19:49604326-49604348 CCTTGTTTTTGGTAGATGTGAGG - Intronic
1168579015 19:57537824-57537846 CCTTATGTGTGCAATATATGTGG + Exonic
925281454 2:2688158-2688180 CCTAGTGTTTGCAGGATCACTGG - Intergenic
929199141 2:39217032-39217054 TCTTCTCTTTGCACGATCTGTGG - Intronic
930932167 2:56899162-56899184 CCTTGTGTTAGCAAAATATGTGG - Intergenic
932085105 2:68750807-68750829 CCCTGTGTGAGCAGGATCTGGGG - Intronic
932214883 2:69960333-69960355 GCTTGTCTTTGAAAGAACTGTGG - Exonic
932772017 2:74505754-74505776 TCTTGTCTTTGCCAGAACTGGGG + Exonic
932910009 2:75796363-75796385 CCTAGTGATTCCCAGATCTGTGG + Intergenic
933252456 2:80044244-80044266 CCTAGTGTTTGAAAGGTGTGCGG - Intronic
933920478 2:87040482-87040504 CCTTTTCTTTACAAGATTTGAGG + Intergenic
933931146 2:87153304-87153326 CCTTTTCTTTACAAGATTTGAGG - Intergenic
934002519 2:87729416-87729438 CCTTTTCTTTACAAGATTTGAGG - Intergenic
936361977 2:111812128-111812150 CCTTTTCTTTACAAGATTTGAGG + Intronic
936436824 2:112515244-112515266 GCTTGTTTTTGTAAGGTCTGTGG + Intronic
937128284 2:119488316-119488338 CCCTGGCTTTGCAAGAGCTGTGG - Intronic
937182101 2:120006057-120006079 CCTTGTGGTAGAAAGATCAGTGG - Intergenic
938541115 2:132284389-132284411 CCTTTTGTTTCTAAGTTCTGGGG + Intergenic
940069248 2:149666426-149666448 ACTTGTGTTAGCAGGCTCTGAGG - Intergenic
945036747 2:205710202-205710224 CCTTGTGGGAGGAAGATCTGAGG - Intronic
945538289 2:211048639-211048661 TCTTCTGTTTGCCACATCTGTGG - Intergenic
947919765 2:233859263-233859285 CCTTGGCTTTGCAAAATCAGGGG + Intergenic
948294031 2:236847749-236847771 CCCTGTGTCTGCAAGATCACTGG + Intergenic
1171510174 20:25675891-25675913 CCTTTTGTGTGCAAGGACTGTGG - Exonic
1171870026 20:30517394-30517416 CCTTTTGTTTCTAAGTTCTGGGG + Intergenic
1172714752 20:36954465-36954487 ACTTGTGTTTATAAGACCTGTGG + Intergenic
1173216826 20:41093200-41093222 CCTTGGGTTTGAAGGATTTGAGG + Intronic
1174609689 20:51788892-51788914 CCTTTTGTGTGCAACATTTGTGG - Exonic
1180057981 21:45368818-45368840 CCTTGTGCTTGCAGGATCCTGGG + Intergenic
1180733475 22:17999479-17999501 CCTTGGGTTTGAGAGACCTGGGG - Intronic
1182995373 22:34807357-34807379 CACTGTGTTTGAAAGAGCTGTGG + Intergenic
950951988 3:17010050-17010072 CCAGATGTTTGCAACATCTGCGG - Exonic
951655277 3:25000299-25000321 CCTTGAATTTGCAAGGTCTATGG - Intergenic
953540996 3:43818044-43818066 CCTTGTGCTTCCAGGAACTGAGG + Intergenic
953590143 3:44243338-44243360 TCTTCTGTTTGTAAGAGCTGAGG - Exonic
955402711 3:58604634-58604656 CCTTGTGTTTCAAAGATTTTGGG + Intronic
961521684 3:127470780-127470802 CCTTGTGGTGACAAGAGCTGGGG + Intergenic
964255449 3:154770168-154770190 CCTTGTTTTTGTCAGTTCTGTGG + Intergenic
965163936 3:165170401-165170423 TCTTCTGTTTCCAAGTTCTGAGG + Intergenic
965893492 3:173544599-173544621 CATTGAGTTTGAATGATCTGTGG + Intronic
968560806 4:1280744-1280766 TCTTGTATATGCAAGATTTGGGG - Intergenic
973786451 4:54337109-54337131 CCTTGTGTTTGAAATACCTAGGG - Intergenic
975589631 4:75987299-75987321 ACTAGTGTTTGCCAGAGCTGAGG - Intronic
977711174 4:100127398-100127420 CCATGTGTTTTCAAGAATTGGGG - Intergenic
978754087 4:112284868-112284890 CTTTGTTTTTGCAAGACCTGTGG - Intronic
979420242 4:120495222-120495244 CCTGGTGTTTGCATCATGTGTGG - Intergenic
986469087 5:8056690-8056712 CCTTGGGTCTGAAAAATCTGTGG + Intergenic
987683367 5:21165647-21165669 TCTTGTGCTTGCAAAATCTTTGG - Intergenic
988100786 5:26674716-26674738 GCTTCTGTTTGCAAGATGTGCGG - Intergenic
989830382 5:45910010-45910032 CATTGTTTTTGTAGGATCTGTGG + Intergenic
991416270 5:66396148-66396170 CCTTGTGTTTTCAGAAACTGGGG + Intergenic
992461558 5:76965492-76965514 CCTTTTGGGTGCATGATCTGAGG + Intronic
992653338 5:78883661-78883683 CCTTGGGTTTGTAAGAGATGAGG + Intronic
993590323 5:89787481-89787503 CCTATTGTTGGCAGGATCTGAGG - Intergenic
993637892 5:90367410-90367432 CCTTCTGTAAGCAAGAGCTGTGG - Intergenic
994829195 5:104756371-104756393 TCTTGTGTTTGCAAGAATTTGGG + Intergenic
994971880 5:106749572-106749594 CCTTGTGGTTTCAACATGTGGGG - Intergenic
995350988 5:111175387-111175409 ATTTGTGTTTGTAAGATGTGAGG - Intergenic
995906820 5:117134682-117134704 CCTTGTGTTTTTAAATTCTGAGG + Intergenic
998767814 5:145507638-145507660 TCTAGTGTTTGCAAGTGCTGAGG + Intronic
999198633 5:149800464-149800486 CTTTGGATTTGGAAGATCTGGGG + Intronic
1004733378 6:18380802-18380824 CCTTATGTTTGCAAGGTTTACGG - Intergenic
1005514514 6:26540887-26540909 CCTTGTGTTTGCTAGGGATGAGG + Intronic
1005529719 6:26690699-26690721 CCTTGTGGCTGCAACATCTGTGG - Intergenic
1005541077 6:26810948-26810970 CCTTGTGGCTGCAACATCTGTGG + Intergenic
1009011890 6:57853036-57853058 CATTGTGGCTGCAACATCTGTGG + Intergenic
1009465664 6:63965750-63965772 CTTGGTATTTGTAAGATCTGGGG + Intronic
1009867130 6:69411586-69411608 CCTTGTATTTGCATGGTTTGAGG - Intergenic
1011897746 6:92253090-92253112 CTCTGTGTTTGCAAGAAATGAGG - Intergenic
1016379890 6:143465931-143465953 ACTTGTGTTTTCTATATCTGTGG + Intronic
1017540736 6:155399909-155399931 CCATGCGTGTGCAAGCTCTGTGG - Intronic
1019059546 6:169246239-169246261 CCTAGTGTTTGAAAACTCTGTGG - Exonic
1019956995 7:4423553-4423575 CCTTGGGTTTGCACACTCTGTGG + Intergenic
1021163507 7:17305065-17305087 CCTTTTGTTTGCTATACCTGAGG - Intronic
1022508305 7:30920465-30920487 CATTGTGTGTGCAGGATCTGGGG - Intronic
1023415429 7:39927726-39927748 CCATCTGTTTGCAACCTCTGCGG - Intergenic
1024476205 7:49814498-49814520 CCTTTTGCTTGCAAGCACTGGGG + Intronic
1031933420 7:127710073-127710095 ACTTGTTTTTGCATGATCTGTGG + Intronic
1032047679 7:128622917-128622939 CCTTGTATCTGTAAGGTCTGGGG + Intergenic
1032951815 7:136923166-136923188 CCTTGTGGCTGCCAGATGTGTGG - Intronic
1033564985 7:142569716-142569738 CCATGTGTTGCAAAGATCTGTGG - Intergenic
1034530111 7:151690329-151690351 CCCTCTGTTTGCATGATCTGAGG + Intronic
1037345776 8:17899395-17899417 CTGTGTGTTTGCAAGGACTGTGG + Intronic
1038523920 8:28257151-28257173 CCTTGTGCTAACAACATCTGGGG + Intergenic
1039264528 8:35809624-35809646 CTTTGTTTTTGGAAGATTTGAGG - Intergenic
1040604652 8:48919949-48919971 CCTTGTGTTTGCAAGATCTGCGG - Exonic
1047346705 8:124035776-124035798 TCTTGTGCTTACATGATCTGTGG + Intronic
1049114482 8:140674251-140674273 CCTTCTGCTTGCAGGATTTGTGG - Intronic
1049660543 8:143817877-143817899 CCTTGTGCTTGCCAGTTGTGGGG + Exonic
1050523230 9:6523474-6523496 CCATGTGGTTTCAAGTTCTGTGG + Intergenic
1055008646 9:71538048-71538070 CCTTGTGTTAGAAATATCAGGGG - Intergenic
1056754740 9:89374608-89374630 CCCTGTGGTTGAAATATCTGGGG + Intronic
1056786039 9:89593210-89593232 GCTTGTGTTTACATGAGCTGTGG + Intergenic
1056840173 9:89992429-89992451 CCTTCTCTGTGCAGGATCTGAGG - Intergenic
1057891156 9:98870976-98870998 TGTTGTGTTTGCAGGCTCTGTGG - Intergenic
1059848185 9:118304671-118304693 GCATGTGTTAGGAAGATCTGAGG - Intergenic
1060851518 9:126880606-126880628 CCCTTTGTGTGCAAGTTCTGTGG + Exonic
1061169803 9:128946016-128946038 CCTTCTGTGTGCAGGGTCTGGGG + Exonic
1185699906 X:2223061-2223083 CTTTGGGTTTGCAAGATCTCTGG - Intronic
1190402736 X:50054958-50054980 CCATATGTTTCTAAGATCTGGGG + Intronic
1190565696 X:51728571-51728593 CCTTGTGTTGGAAAGATGTGGGG + Intergenic
1191640259 X:63424083-63424105 CCTTGGGTGTGCAAGATGTTGGG + Intergenic
1191809840 X:65175048-65175070 TCTTGGGTTTGCAAAAACTGTGG + Intergenic
1193509825 X:82384983-82385005 CCTTGGGTTTGAAAGATATGTGG - Intergenic
1194659140 X:96609376-96609398 CCTTGTGCTTTCAAGTTCTTAGG + Intergenic
1200180528 X:154147633-154147655 CCTTGTGTTAGGAACATATGGGG + Intronic
1200186356 X:154186028-154186050 CCTTGTGTTAGGAACATATGGGG + Intergenic
1200192008 X:154223166-154223188 CCTTGTGTTAGGAACATATGGGG + Intronic
1200197763 X:154260970-154260992 CCTTGTGTTAGGAACATATGGGG + Intronic