ID: 1040604656

View in Genome Browser
Species Human (GRCh38)
Location 8:48919980-48920002
Sequence GGGTCCGAATATGCATCTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040604651_1040604656 13 Left 1040604651 8:48919944-48919966 CCTTGCCGCAGATCTTGCAAACA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 44
1040604652_1040604656 8 Left 1040604652 8:48919949-48919971 CCGCAGATCTTGCAAACACAAGG 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 44
1040604650_1040604656 30 Left 1040604650 8:48919927-48919949 CCAGGGTCTGGAAAACGCCTTGC 0: 1
1: 0
2: 1
3: 12
4: 100
Right 1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040604656 Original CRISPR GGGTCCGAATATGCATCTTC AGG Exonic
905356599 1:37389187-37389209 AGGTCTGGATATGCACCTTCTGG - Intergenic
905385456 1:37600381-37600403 GGCTCAGAATATACATCTTCAGG + Intergenic
913478464 1:119261591-119261613 GGGTCCCCAAATGTATCTTCAGG - Intergenic
915935786 1:160089619-160089641 GGGTGAGAATATGCGTCTTTGGG - Exonic
919740389 1:200977644-200977666 GGGTGTGAACATGGATCTTCCGG + Intronic
1074858413 10:117490752-117490774 GGGTCCTGGCATGCATCTTCTGG + Intergenic
1076902230 10:133345424-133345446 GTGTCTGAACATGCAGCTTCGGG + Intronic
1087436975 11:98132716-98132738 GGGTAAGAATATGTATTTTCTGG + Intergenic
1113080639 13:106516259-106516281 GGGTCAGAAACTGCATCTGCAGG - Intronic
1113433607 13:110271331-110271353 GGCTCCTAATATGTATCTTGTGG - Intronic
1116968340 14:51038496-51038518 TGCTCAGAATATGCATCTCCTGG + Intronic
1125519298 15:40339300-40339322 GGGTATGAAGATGCATCTACTGG + Intronic
1126035961 15:44545991-44546013 GGTTTTAAATATGCATCTTCTGG + Intronic
1131349757 15:91688434-91688456 TGTTCAGAATAGGCATCTTCAGG + Intergenic
1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG + Intergenic
1151744507 17:76004728-76004750 GGGTCAGTATTTTCATCTTCAGG + Intronic
1160157197 18:76442805-76442827 GGCTCCGGATGTGAATCTTCAGG + Exonic
1162797315 19:13093720-13093742 AGGTCCCAAGATGCATTTTCAGG + Intronic
1165582886 19:36884439-36884461 GGGTCCAAAGATGAGTCTTCTGG + Intronic
926006331 2:9376016-9376038 GGGACCAAATGTGCATCTACAGG - Intronic
926396226 2:12445566-12445588 TGGTCACAAGATGCATCTTCCGG + Intergenic
941752424 2:169147185-169147207 GGGTCTGAATATCCATCCTTCGG - Intronic
1169995033 20:11546817-11546839 GGGCCCGTATTTGCATCCTCAGG + Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1178396475 21:32247872-32247894 GGGTGCCTATATGAATCTTCCGG - Intergenic
1180064969 21:45407763-45407785 GGGGCAGGACATGCATCTTCTGG - Intronic
1185057599 22:48589067-48589089 GGGTCTGAAGATGGATTTTCTGG - Intronic
951284147 3:20788808-20788830 GGGGCTGACTATGCATTTTCGGG + Intergenic
951876681 3:27434477-27434499 GGGTCCTGATATTCATCTGCTGG - Intronic
960896444 3:122511199-122511221 GGGTCAGAATAGGCAGCTTGGGG - Intronic
960896448 3:122511219-122511241 GGGTCAGAATAGGCAGCTTGGGG - Intronic
972991825 4:44829926-44829948 GAGTCAGAATGTGCATCTGCTGG + Intergenic
983925893 4:173401742-173401764 GGGTCCAAATGTGCTTCTTAGGG - Intronic
984260700 4:177441402-177441424 GGGTCTGAAAATGACTCTTCTGG + Intronic
987849621 5:23333630-23333652 GGGTCACAATATGGGTCTTCAGG - Intergenic
989921661 5:49812730-49812752 TGGTCCGAATATCCACTTTCAGG - Intergenic
990594011 5:57294977-57294999 TGGTGGGAATATGCATCTTTTGG + Intergenic
994427648 5:99613811-99613833 GTGTTCAAATATTCATCTTCAGG - Intergenic
994870700 5:105346971-105346993 TGGTCCAAATATAGATCTTCAGG - Intergenic
1001327237 5:170737987-170738009 GGGTCCTAACCTGCATCTTGAGG + Intergenic
1012221435 6:96653631-96653653 GGTTCCAAATATGCATCTCCTGG - Intergenic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1042751744 8:72164805-72164827 GTGTCTGAATATGCCTATTCAGG + Intergenic
1048592838 8:135837493-135837515 TGGGCTGAAAATGCATCTTCAGG - Intergenic
1052930287 9:34050082-34050104 TCGACCGAATATGCAGCTTCGGG - Intergenic
1197133151 X:123029336-123029358 GGGTGCCCATATGCAACTTCTGG + Intergenic
1199656912 X:150005543-150005565 GTGTCAGAATATTCATCTTTGGG + Intergenic