ID: 1040605118

View in Genome Browser
Species Human (GRCh38)
Location 8:48923919-48923941
Sequence TTGGATTAGCAAACCCACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040605118_1040605121 -8 Left 1040605118 8:48923919-48923941 CCCAAGTGGGTTTGCTAATCCAA No data
Right 1040605121 8:48923934-48923956 TAATCCAAGGATTCAGTCCTAGG No data
1040605118_1040605127 30 Left 1040605118 8:48923919-48923941 CCCAAGTGGGTTTGCTAATCCAA No data
Right 1040605127 8:48923972-48923994 TGCTCCATAATTAGGCTGATTGG No data
1040605118_1040605123 -4 Left 1040605118 8:48923919-48923941 CCCAAGTGGGTTTGCTAATCCAA No data
Right 1040605123 8:48923938-48923960 CCAAGGATTCAGTCCTAGGTTGG No data
1040605118_1040605126 22 Left 1040605118 8:48923919-48923941 CCCAAGTGGGTTTGCTAATCCAA No data
Right 1040605126 8:48923964-48923986 GAAATTGGTGCTCCATAATTAGG No data
1040605118_1040605124 7 Left 1040605118 8:48923919-48923941 CCCAAGTGGGTTTGCTAATCCAA No data
Right 1040605124 8:48923949-48923971 GTCCTAGGTTGGTGAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040605118 Original CRISPR TTGGATTAGCAAACCCACTT GGG (reversed) Intergenic
No off target data available for this crispr