ID: 1040605119

View in Genome Browser
Species Human (GRCh38)
Location 8:48923920-48923942
Sequence CTTGGATTAGCAAACCCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040605119_1040605126 21 Left 1040605119 8:48923920-48923942 CCAAGTGGGTTTGCTAATCCAAG No data
Right 1040605126 8:48923964-48923986 GAAATTGGTGCTCCATAATTAGG No data
1040605119_1040605124 6 Left 1040605119 8:48923920-48923942 CCAAGTGGGTTTGCTAATCCAAG No data
Right 1040605124 8:48923949-48923971 GTCCTAGGTTGGTGAGAAATTGG No data
1040605119_1040605121 -9 Left 1040605119 8:48923920-48923942 CCAAGTGGGTTTGCTAATCCAAG No data
Right 1040605121 8:48923934-48923956 TAATCCAAGGATTCAGTCCTAGG No data
1040605119_1040605127 29 Left 1040605119 8:48923920-48923942 CCAAGTGGGTTTGCTAATCCAAG No data
Right 1040605127 8:48923972-48923994 TGCTCCATAATTAGGCTGATTGG No data
1040605119_1040605128 30 Left 1040605119 8:48923920-48923942 CCAAGTGGGTTTGCTAATCCAAG No data
Right 1040605128 8:48923973-48923995 GCTCCATAATTAGGCTGATTGGG No data
1040605119_1040605123 -5 Left 1040605119 8:48923920-48923942 CCAAGTGGGTTTGCTAATCCAAG No data
Right 1040605123 8:48923938-48923960 CCAAGGATTCAGTCCTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040605119 Original CRISPR CTTGGATTAGCAAACCCACT TGG (reversed) Intergenic