ID: 1040605122

View in Genome Browser
Species Human (GRCh38)
Location 8:48923938-48923960
Sequence CCAACCTAGGACTGAATCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040605122_1040605126 3 Left 1040605122 8:48923938-48923960 CCAAGGATTCAGTCCTAGGTTGG No data
Right 1040605126 8:48923964-48923986 GAAATTGGTGCTCCATAATTAGG No data
1040605122_1040605127 11 Left 1040605122 8:48923938-48923960 CCAAGGATTCAGTCCTAGGTTGG No data
Right 1040605127 8:48923972-48923994 TGCTCCATAATTAGGCTGATTGG No data
1040605122_1040605128 12 Left 1040605122 8:48923938-48923960 CCAAGGATTCAGTCCTAGGTTGG No data
Right 1040605128 8:48923973-48923995 GCTCCATAATTAGGCTGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040605122 Original CRISPR CCAACCTAGGACTGAATCCT TGG (reversed) Intergenic
No off target data available for this crispr