ID: 1040605123

View in Genome Browser
Species Human (GRCh38)
Location 8:48923938-48923960
Sequence CCAAGGATTCAGTCCTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040605119_1040605123 -5 Left 1040605119 8:48923920-48923942 CCAAGTGGGTTTGCTAATCCAAG No data
Right 1040605123 8:48923938-48923960 CCAAGGATTCAGTCCTAGGTTGG No data
1040605118_1040605123 -4 Left 1040605118 8:48923919-48923941 CCCAAGTGGGTTTGCTAATCCAA No data
Right 1040605123 8:48923938-48923960 CCAAGGATTCAGTCCTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040605123 Original CRISPR CCAAGGATTCAGTCCTAGGT TGG Intergenic
No off target data available for this crispr