ID: 1040605125 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:48923951-48923973 |
Sequence | CACCAATTTCTCACCAACCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1040605125_1040605126 | -10 | Left | 1040605125 | 8:48923951-48923973 | CCTAGGTTGGTGAGAAATTGGTG | No data | ||
Right | 1040605126 | 8:48923964-48923986 | GAAATTGGTGCTCCATAATTAGG | No data | ||||
1040605125_1040605128 | -1 | Left | 1040605125 | 8:48923951-48923973 | CCTAGGTTGGTGAGAAATTGGTG | No data | ||
Right | 1040605128 | 8:48923973-48923995 | GCTCCATAATTAGGCTGATTGGG | No data | ||||
1040605125_1040605127 | -2 | Left | 1040605125 | 8:48923951-48923973 | CCTAGGTTGGTGAGAAATTGGTG | No data | ||
Right | 1040605127 | 8:48923972-48923994 | TGCTCCATAATTAGGCTGATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1040605125 | Original CRISPR | CACCAATTTCTCACCAACCT AGG (reversed) | Intergenic | ||