ID: 1040605126

View in Genome Browser
Species Human (GRCh38)
Location 8:48923964-48923986
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040605125_1040605126 -10 Left 1040605125 8:48923951-48923973 CCTAGGTTGGTGAGAAATTGGTG No data
Right 1040605126 8:48923964-48923986 GAAATTGGTGCTCCATAATTAGG No data
1040605119_1040605126 21 Left 1040605119 8:48923920-48923942 CCAAGTGGGTTTGCTAATCCAAG No data
Right 1040605126 8:48923964-48923986 GAAATTGGTGCTCCATAATTAGG No data
1040605118_1040605126 22 Left 1040605118 8:48923919-48923941 CCCAAGTGGGTTTGCTAATCCAA No data
Right 1040605126 8:48923964-48923986 GAAATTGGTGCTCCATAATTAGG No data
1040605122_1040605126 3 Left 1040605122 8:48923938-48923960 CCAAGGATTCAGTCCTAGGTTGG No data
Right 1040605126 8:48923964-48923986 GAAATTGGTGCTCCATAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040605126 Original CRISPR GAAATTGGTGCTCCATAATT AGG Intergenic