ID: 1040605128

View in Genome Browser
Species Human (GRCh38)
Location 8:48923973-48923995
Sequence GCTCCATAATTAGGCTGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040605125_1040605128 -1 Left 1040605125 8:48923951-48923973 CCTAGGTTGGTGAGAAATTGGTG No data
Right 1040605128 8:48923973-48923995 GCTCCATAATTAGGCTGATTGGG No data
1040605122_1040605128 12 Left 1040605122 8:48923938-48923960 CCAAGGATTCAGTCCTAGGTTGG No data
Right 1040605128 8:48923973-48923995 GCTCCATAATTAGGCTGATTGGG No data
1040605119_1040605128 30 Left 1040605119 8:48923920-48923942 CCAAGTGGGTTTGCTAATCCAAG No data
Right 1040605128 8:48923973-48923995 GCTCCATAATTAGGCTGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040605128 Original CRISPR GCTCCATAATTAGGCTGATT GGG Intergenic
No off target data available for this crispr