ID: 1040605428

View in Genome Browser
Species Human (GRCh38)
Location 8:48927082-48927104
Sequence AGCAAGGCAGGCACACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040605428_1040605435 12 Left 1040605428 8:48927082-48927104 CCATGTGGTGTGCCTGCCTTGCT No data
Right 1040605435 8:48927117-48927139 TCCATAGGTTCCCATGGCAGTGG No data
1040605428_1040605431 -3 Left 1040605428 8:48927082-48927104 CCATGTGGTGTGCCTGCCTTGCT No data
Right 1040605431 8:48927102-48927124 GCTCCAGAATAAGCCTCCATAGG No data
1040605428_1040605438 22 Left 1040605428 8:48927082-48927104 CCATGTGGTGTGCCTGCCTTGCT No data
Right 1040605438 8:48927127-48927149 CCCATGGCAGTGGACATGTTTGG No data
1040605428_1040605433 6 Left 1040605428 8:48927082-48927104 CCATGTGGTGTGCCTGCCTTGCT No data
Right 1040605433 8:48927111-48927133 TAAGCCTCCATAGGTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040605428 Original CRISPR AGCAAGGCAGGCACACCACA TGG (reversed) Intergenic
No off target data available for this crispr