ID: 1040610262

View in Genome Browser
Species Human (GRCh38)
Location 8:48976819-48976841
Sequence CCAGGGTCTCCAAAGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040610253_1040610262 7 Left 1040610253 8:48976789-48976811 CCAGCCACACTTCCTTCGTATTT No data
Right 1040610262 8:48976819-48976841 CCAGGGTCTCCAAAGACAGAAGG No data
1040610252_1040610262 8 Left 1040610252 8:48976788-48976810 CCCAGCCACACTTCCTTCGTATT No data
Right 1040610262 8:48976819-48976841 CCAGGGTCTCCAAAGACAGAAGG No data
1040610254_1040610262 3 Left 1040610254 8:48976793-48976815 CCACACTTCCTTCGTATTTCCCA No data
Right 1040610262 8:48976819-48976841 CCAGGGTCTCCAAAGACAGAAGG No data
1040610251_1040610262 9 Left 1040610251 8:48976787-48976809 CCCCAGCCACACTTCCTTCGTAT No data
Right 1040610262 8:48976819-48976841 CCAGGGTCTCCAAAGACAGAAGG No data
1040610250_1040610262 10 Left 1040610250 8:48976786-48976808 CCCCCAGCCACACTTCCTTCGTA No data
Right 1040610262 8:48976819-48976841 CCAGGGTCTCCAAAGACAGAAGG No data
1040610255_1040610262 -5 Left 1040610255 8:48976801-48976823 CCTTCGTATTTCCCAAGCCCAGG No data
Right 1040610262 8:48976819-48976841 CCAGGGTCTCCAAAGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040610262 Original CRISPR CCAGGGTCTCCAAAGACAGA AGG Intergenic
No off target data available for this crispr