ID: 1040610880

View in Genome Browser
Species Human (GRCh38)
Location 8:48980864-48980886
Sequence CTACTTTAGCAACTGTAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040610875_1040610880 4 Left 1040610875 8:48980837-48980859 CCTGGAGTCTGACCGGGGCTGGG No data
Right 1040610880 8:48980864-48980886 CTACTTTAGCAACTGTAACCTGG No data
1040610872_1040610880 8 Left 1040610872 8:48980833-48980855 CCACCCTGGAGTCTGACCGGGGC No data
Right 1040610880 8:48980864-48980886 CTACTTTAGCAACTGTAACCTGG No data
1040610879_1040610880 -8 Left 1040610879 8:48980849-48980871 CCGGGGCTGGGGGCTCTACTTTA No data
Right 1040610880 8:48980864-48980886 CTACTTTAGCAACTGTAACCTGG No data
1040610873_1040610880 5 Left 1040610873 8:48980836-48980858 CCCTGGAGTCTGACCGGGGCTGG No data
Right 1040610880 8:48980864-48980886 CTACTTTAGCAACTGTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040610880 Original CRISPR CTACTTTAGCAACTGTAACC TGG Intergenic
No off target data available for this crispr