ID: 1040619519

View in Genome Browser
Species Human (GRCh38)
Location 8:49074732-49074754
Sequence TGTGGTGCAAATTACTAGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040619517_1040619519 13 Left 1040619517 8:49074696-49074718 CCTTAGGATAACACTGCTGATTT 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1040619519 8:49074732-49074754 TGTGGTGCAAATTACTAGACAGG 0: 1
1: 0
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040619519 Original CRISPR TGTGGTGCAAATTACTAGAC AGG Exonic
901583392 1:10265087-10265109 TGTGGTGCAAATTACTCAGGAGG - Intronic
902731177 1:18369878-18369900 TGTGGTCCAGATTACGAGAAAGG - Intronic
903387986 1:22942170-22942192 TGTGGTCCAAACTACTTGAGAGG - Intergenic
912874995 1:113348898-113348920 TGGGGTTCAAATCACTAGCCGGG + Intergenic
916603762 1:166320928-166320950 TGATGTGCTTATTACTAGACTGG - Intergenic
917220459 1:172723096-172723118 TGAGGTGCAAATTATTAGCAGGG + Intergenic
918676281 1:187290015-187290037 TGTAGTCCAAATTACTTGGCAGG - Intergenic
921944024 1:220874202-220874224 TGTGCTTAAAATCACTAGACCGG - Intergenic
924287855 1:242506757-242506779 TGTGGAGCGAAATACTGGACGGG + Intronic
924498401 1:244612590-244612612 TGTGGCTGAAAATACTAGACTGG + Intronic
1068909661 10:62365651-62365673 TTTGGGGCCAATTACTACACAGG + Intergenic
1071913811 10:90267760-90267782 TGTGATCCTAATTAGTAGACAGG - Intergenic
1081742517 11:45450452-45450474 TGTCGTCGAAATTACTGGACAGG + Intergenic
1082641595 11:55667628-55667650 TGTGGAGCAGAGTACTAGAGAGG + Intergenic
1084466633 11:69327093-69327115 TGTGGGGTACATTCCTAGACGGG + Intronic
1086546487 11:87973602-87973624 TTTGGTGTAGGTTACTAGACAGG + Intergenic
1087592740 11:100212552-100212574 TGTGGTAAAAGTTACTAGACAGG + Intronic
1087854897 11:103079660-103079682 TGTGGTCCCAATTACTTGAGAGG + Intronic
1095520547 12:43059332-43059354 TGTGGTCCCAGTTACTAGAGAGG + Intergenic
1095847892 12:46766471-46766493 TGTGGTGCACATTTCTACCCAGG - Exonic
1098850469 12:75589890-75589912 TGAGGTCCAAATAACTTGACTGG + Intergenic
1099140863 12:78973652-78973674 TGTGCTCCAACTTACTACACAGG + Intronic
1105553221 13:21418172-21418194 TGTGATGCATATTAGTAAACAGG + Intronic
1112883678 13:104141476-104141498 TGAAGTACAAATTACTACACGGG + Intergenic
1113063120 13:106345571-106345593 TGTGGTGAAAATTATTAGGTGGG - Intergenic
1114628061 14:24142108-24142130 TGTGCTGCGAAGCACTAGACTGG - Intergenic
1117582387 14:57165262-57165284 TGTGGTGCTAACTACTTGAGAGG - Intergenic
1118014387 14:61643507-61643529 TGAGTTGCACACTACTAGACCGG + Intronic
1132209077 15:100007257-100007279 TGTGGTGCAACTGACAAGTCTGG + Intronic
1141146197 16:81531834-81531856 TCTGTTGCAAATTACTAGTTGGG + Intronic
1141489522 16:84362769-84362791 TTTGGTGCAAATGCATAGACCGG + Intergenic
1143348630 17:6269948-6269970 TGTGGGGGAAATTACAAGTCAGG - Intergenic
1143904122 17:10196428-10196450 TCTGTTGCAAGTTACTAGTCAGG + Intronic
1150889705 17:69133602-69133624 AGTAGTGCAAATTAATAAACAGG - Intronic
1159169685 18:64749672-64749694 TGTTGTGGAAAATACAAGACAGG - Intergenic
1165499032 19:36172898-36172920 TGTGGTCCAAGTTACTAGGGAGG - Intergenic
1165676126 19:37725396-37725418 TGTGGAACAAAGTACTAGACAGG - Intergenic
927258374 2:21060807-21060829 TATGGTTCAAACTAATAGACAGG - Intergenic
937281530 2:120720608-120720630 TGTAGTCCCAATTACTAGAGAGG + Intergenic
941065491 2:160898161-160898183 TGTTGTGCTATTTATTAGACAGG - Intergenic
944723559 2:202447518-202447540 TGTGTTTTAAAATACTAGACAGG + Intronic
1169902381 20:10566644-10566666 TGTGATGCAAATTATGAGGCAGG - Intronic
1173550764 20:43931685-43931707 TGTGGGGGAAAATACTGGACGGG + Intronic
1175016142 20:55792743-55792765 TGTTGGGCAAATTACTTAACTGG - Intergenic
1175359577 20:58398204-58398226 TGTACTGCATATTACTAGCCTGG + Intronic
1177513294 21:22117665-22117687 TGTGGTCCCAACTACTAGAGAGG + Intergenic
1177960905 21:27664746-27664768 TGTGGTCCCAGCTACTAGACAGG + Intergenic
1180214083 21:46313844-46313866 TGAGGTGGGAATTTCTAGACAGG - Intronic
1181913266 22:26257439-26257461 TATGGAGGAAATTAATAGACAGG - Intronic
1183259890 22:36787938-36787960 TGTGGTGCAAATAACCCCACAGG + Intergenic
949329010 3:2900549-2900571 TGTTATGCAAATAACAAGACTGG - Intronic
949851591 3:8426173-8426195 TGTGGTGGAAAGTTCTAGTCAGG - Intergenic
950286240 3:11747364-11747386 TGTGATGGAACTTTCTAGACTGG + Intergenic
951601061 3:24376409-24376431 TGTGGAGCAAAGTATTAGAGAGG + Intronic
953339852 3:42124243-42124265 TGTGGTGCACACAACTAGACAGG - Intronic
957662166 3:83172774-83172796 TGTGGAGCAAAATACTATAATGG - Intergenic
959520895 3:107321939-107321961 TGTGGTGCCATTTACTGAACTGG + Intergenic
959531552 3:107439714-107439736 TGTGTTGAAAATAACTAGAAAGG + Intergenic
960691532 3:120350921-120350943 TGTGGTGCCAACTACTACACAGG + Intergenic
963161182 3:142151870-142151892 TGTTGTGCAAATTGCTAAATTGG - Intergenic
964439682 3:156694481-156694503 TGTCGTGAAAATTACTCCACAGG - Intronic
966655956 3:182359063-182359085 GGTGGTGCAATTTACTGGAAAGG - Intergenic
968834822 4:2955488-2955510 TGTGGTGCAGGTGACTAGAGGGG - Intronic
968865995 4:3212189-3212211 CTTGGTGCAAAGTACTATACTGG - Intronic
971685650 4:29763241-29763263 TTTGGTGAAAATTAATACACTGG - Intergenic
971705393 4:30035480-30035502 TGTGATGCAAATTTCTCCACGGG - Intergenic
976968554 4:91076929-91076951 TGTGGGGCAGATTACCAGAGAGG + Intronic
977304011 4:95300472-95300494 TGTGGTCCAATGTACTAGAATGG + Intronic
981968576 4:150636767-150636789 TGTGGTGCCAATTACTTGGGAGG - Intronic
985126570 4:186700847-186700869 TGTCGTGGTTATTACTAGACTGG + Intronic
986259767 5:6134302-6134324 TGTGGTGCAATTCAGCAGACAGG + Intergenic
987555392 5:19440336-19440358 TGTGGTCCAAGCTACTTGACAGG - Intergenic
992561696 5:77958385-77958407 CCTGGGGCAAATTGCTAGACAGG + Intergenic
993523277 5:88932258-88932280 TATGCTGCAAAGTACTAGTCGGG + Intergenic
995208224 5:109506639-109506661 TGTCGTGACAATTTCTAGACTGG - Intergenic
997319469 5:132965416-132965438 TGTGGTCCTAACTACTAGAGAGG + Intergenic
1000256709 5:159545903-159545925 TGTGTTGCTTATTCCTAGACAGG - Intergenic
1003700876 6:8463489-8463511 TTTTGTGCAAATCACTACACAGG - Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1008861487 6:56154410-56154432 TGTGGTGCCATTTACTGTACTGG - Intronic
1010593613 6:77738365-77738387 AGTGATGCAAATTGCTAGAATGG + Intronic
1011672892 6:89701073-89701095 TATGTAGCAAATTACTAAACAGG + Intronic
1015527162 6:134184803-134184825 TGTGGTCCCAACTACTAGAGAGG - Intronic
1015661222 6:135575734-135575756 TGTTGTGCAAATTATTACATTGG - Intergenic
1022164420 7:27743212-27743234 AAGGGTGCAAATTAATAGACTGG + Intronic
1023450165 7:40275778-40275800 TGTTGTGCTAAATACTAAACTGG + Intronic
1028112420 7:86958006-86958028 TGTGATGCAAATTAATATCCTGG - Intronic
1031906848 7:127469869-127469891 TGTGGTGTATATTTCTAGCCTGG + Intergenic
1032552211 7:132794733-132794755 TGTGCTGAAATTTACTAAACAGG - Intronic
1038721061 8:30035676-30035698 TGTGGTTCAACTTAATATACTGG + Intergenic
1040619519 8:49074732-49074754 TGTGGTGCAAATTACTAGACAGG + Exonic
1041009794 8:53530565-53530587 TATAGTGTAAATTACTAGAGTGG + Intergenic
1046303114 8:112324254-112324276 TATGGTGCCAATTTCTAGGCTGG - Intronic
1047700554 8:127445433-127445455 TGTGGTTCAAAGTGCTAGTCCGG + Intergenic
1049142250 8:140965511-140965533 TGTGGTGAAGCTTACTAGAGAGG + Intronic
1052037348 9:23697441-23697463 TGTCTTGCTAATTACTATACTGG - Intronic
1053596095 9:39563264-39563286 TGTGGTCCCAATTACTAGGGTGG + Intergenic
1054570161 9:66801752-66801774 TGTGGTCCCAATTACTAGGGTGG - Intergenic
1054970488 9:71080242-71080264 TCTCGTTCCAATTACTAGACTGG - Intronic
1054978185 9:71172526-71172548 TGTGGTGCCAGTTACTCGAGAGG - Intronic
1057553982 9:96072936-96072958 TTTGGTGCAGATTATCAGACAGG + Intergenic
1188632170 X:32377184-32377206 TGTGATGAAAATTAATATACTGG - Intronic
1200108676 X:153727934-153727956 TGTGGTCCAAATTCCCACACTGG + Intronic