ID: 1040621942

View in Genome Browser
Species Human (GRCh38)
Location 8:49101312-49101334
Sequence GGTACCAAGATACCCCAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040621933_1040621942 10 Left 1040621933 8:49101279-49101301 CCACTGCCACCCCTGCAGCTTGC No data
Right 1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG No data
1040621934_1040621942 4 Left 1040621934 8:49101285-49101307 CCACCCCTGCAGCTTGCTTCTGA No data
Right 1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG No data
1040621939_1040621942 -1 Left 1040621939 8:49101290-49101312 CCTGCAGCTTGCTTCTGATGGGG No data
Right 1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG No data
1040621931_1040621942 22 Left 1040621931 8:49101267-49101289 CCTCCAGGGAGGCCACTGCCACC No data
Right 1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG No data
1040621932_1040621942 19 Left 1040621932 8:49101270-49101292 CCAGGGAGGCCACTGCCACCCCT No data
Right 1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG No data
1040621929_1040621942 24 Left 1040621929 8:49101265-49101287 CCCCTCCAGGGAGGCCACTGCCA No data
Right 1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG No data
1040621930_1040621942 23 Left 1040621930 8:49101266-49101288 CCCTCCAGGGAGGCCACTGCCAC No data
Right 1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG No data
1040621937_1040621942 0 Left 1040621937 8:49101289-49101311 CCCTGCAGCTTGCTTCTGATGGG No data
Right 1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG No data
1040621928_1040621942 30 Left 1040621928 8:49101259-49101281 CCTCTGCCCCTCCAGGGAGGCCA No data
Right 1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG No data
1040621935_1040621942 1 Left 1040621935 8:49101288-49101310 CCCCTGCAGCTTGCTTCTGATGG No data
Right 1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040621942 Original CRISPR GGTACCAAGATACCCCAAAT TGG Intergenic
No off target data available for this crispr