ID: 1040623746

View in Genome Browser
Species Human (GRCh38)
Location 8:49120078-49120100
Sequence TCTTAAAAGAATGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040623746_1040623749 -3 Left 1040623746 8:49120078-49120100 CCTTCCACCTCATTCTTTTAAGA No data
Right 1040623749 8:49120098-49120120 AGATTGTTTTAGCTACTAGCAGG No data
1040623746_1040623751 26 Left 1040623746 8:49120078-49120100 CCTTCCACCTCATTCTTTTAAGA No data
Right 1040623751 8:49120127-49120149 GCTTTCCATATATCTTTTAGAGG No data
1040623746_1040623750 4 Left 1040623746 8:49120078-49120100 CCTTCCACCTCATTCTTTTAAGA No data
Right 1040623750 8:49120105-49120127 TTTAGCTACTAGCAGGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040623746 Original CRISPR TCTTAAAAGAATGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr