ID: 1040626570

View in Genome Browser
Species Human (GRCh38)
Location 8:49156633-49156655
Sequence CGGGGCTCATGTAACCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040626570_1040626579 9 Left 1040626570 8:49156633-49156655 CCCCCATGGTTACATGAGCCCCG No data
Right 1040626579 8:49156665-49156687 CCTCTGACCAGAGGCTTCCCTGG No data
1040626570_1040626577 0 Left 1040626570 8:49156633-49156655 CCCCCATGGTTACATGAGCCCCG No data
Right 1040626577 8:49156656-49156678 CTTCGTCTTCCTCTGACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040626570 Original CRISPR CGGGGCTCATGTAACCATGG GGG (reversed) Intergenic
No off target data available for this crispr