ID: 1040629711

View in Genome Browser
Species Human (GRCh38)
Location 8:49196404-49196426
Sequence CTTTGGGTTTGTAATCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040629701_1040629711 28 Left 1040629701 8:49196353-49196375 CCATGTGATCACAGTGCTGCCTT No data
Right 1040629711 8:49196404-49196426 CTTTGGGTTTGTAATCAGGAGGG No data
1040629703_1040629711 9 Left 1040629703 8:49196372-49196394 CCTTGCTTTCTGGCAGCCTCCTT No data
Right 1040629711 8:49196404-49196426 CTTTGGGTTTGTAATCAGGAGGG No data
1040629708_1040629711 -10 Left 1040629708 8:49196391-49196413 CCTTCTGGCTCTGCTTTGGGTTT No data
Right 1040629711 8:49196404-49196426 CTTTGGGTTTGTAATCAGGAGGG No data
1040629706_1040629711 -7 Left 1040629706 8:49196388-49196410 CCTCCTTCTGGCTCTGCTTTGGG No data
Right 1040629711 8:49196404-49196426 CTTTGGGTTTGTAATCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040629711 Original CRISPR CTTTGGGTTTGTAATCAGGA GGG Intergenic
No off target data available for this crispr