ID: 1040641688

View in Genome Browser
Species Human (GRCh38)
Location 8:49341763-49341785
Sequence CAGCTGGTCTAGAGAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040641688_1040641691 28 Left 1040641688 8:49341763-49341785 CCATGTTTTCTCTAGACCAGCTG No data
Right 1040641691 8:49341814-49341836 AATTTTAAAGTTTCAATGTCAGG No data
1040641688_1040641690 4 Left 1040641688 8:49341763-49341785 CCATGTTTTCTCTAGACCAGCTG No data
Right 1040641690 8:49341790-49341812 AAGTTATTTCTATTTCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040641688 Original CRISPR CAGCTGGTCTAGAGAAAACA TGG (reversed) Intergenic
No off target data available for this crispr