ID: 1040644444

View in Genome Browser
Species Human (GRCh38)
Location 8:49382063-49382085
Sequence ATACATTCTTTTCTAAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040644444_1040644446 -3 Left 1040644444 8:49382063-49382085 CCCAGGCTTAGAAAAGAATGTAT No data
Right 1040644446 8:49382083-49382105 TATGAAAACAGCCCTCCCCGTGG No data
1040644444_1040644458 30 Left 1040644444 8:49382063-49382085 CCCAGGCTTAGAAAAGAATGTAT No data
Right 1040644458 8:49382116-49382138 CCCTGGAGTCATCCGGTCCCTGG No data
1040644444_1040644455 23 Left 1040644444 8:49382063-49382085 CCCAGGCTTAGAAAAGAATGTAT No data
Right 1040644455 8:49382109-49382131 GGTGCACCCCTGGAGTCATCCGG No data
1040644444_1040644452 13 Left 1040644444 8:49382063-49382085 CCCAGGCTTAGAAAAGAATGTAT No data
Right 1040644452 8:49382099-49382121 CCCGTGGCCAGGTGCACCCCTGG No data
1040644444_1040644447 2 Left 1040644444 8:49382063-49382085 CCCAGGCTTAGAAAAGAATGTAT No data
Right 1040644447 8:49382088-49382110 AAACAGCCCTCCCCGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040644444 Original CRISPR ATACATTCTTTTCTAAGCCT GGG (reversed) Intergenic
No off target data available for this crispr