ID: 1040644448

View in Genome Browser
Species Human (GRCh38)
Location 8:49382094-49382116
Sequence GGTGCACCTGGCCACGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040644448_1040644460 7 Left 1040644448 8:49382094-49382116 CCCTCCCCGTGGCCAGGTGCACC No data
Right 1040644460 8:49382124-49382146 TCATCCGGTCCCTGGAATCTTGG No data
1040644448_1040644458 -1 Left 1040644448 8:49382094-49382116 CCCTCCCCGTGGCCAGGTGCACC No data
Right 1040644458 8:49382116-49382138 CCCTGGAGTCATCCGGTCCCTGG No data
1040644448_1040644455 -8 Left 1040644448 8:49382094-49382116 CCCTCCCCGTGGCCAGGTGCACC No data
Right 1040644455 8:49382109-49382131 GGTGCACCCCTGGAGTCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040644448 Original CRISPR GGTGCACCTGGCCACGGGGA GGG (reversed) Intergenic
No off target data available for this crispr