ID: 1040644455

View in Genome Browser
Species Human (GRCh38)
Location 8:49382109-49382131
Sequence GGTGCACCCCTGGAGTCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040644445_1040644455 22 Left 1040644445 8:49382064-49382086 CCAGGCTTAGAAAAGAATGTATG No data
Right 1040644455 8:49382109-49382131 GGTGCACCCCTGGAGTCATCCGG No data
1040644444_1040644455 23 Left 1040644444 8:49382063-49382085 CCCAGGCTTAGAAAAGAATGTAT No data
Right 1040644455 8:49382109-49382131 GGTGCACCCCTGGAGTCATCCGG No data
1040644448_1040644455 -8 Left 1040644448 8:49382094-49382116 CCCTCCCCGTGGCCAGGTGCACC No data
Right 1040644455 8:49382109-49382131 GGTGCACCCCTGGAGTCATCCGG No data
1040644449_1040644455 -9 Left 1040644449 8:49382095-49382117 CCTCCCCGTGGCCAGGTGCACCC No data
Right 1040644455 8:49382109-49382131 GGTGCACCCCTGGAGTCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040644455 Original CRISPR GGTGCACCCCTGGAGTCATC CGG Intergenic
No off target data available for this crispr