ID: 1040644460

View in Genome Browser
Species Human (GRCh38)
Location 8:49382124-49382146
Sequence TCATCCGGTCCCTGGAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040644449_1040644460 6 Left 1040644449 8:49382095-49382117 CCTCCCCGTGGCCAGGTGCACCC No data
Right 1040644460 8:49382124-49382146 TCATCCGGTCCCTGGAATCTTGG No data
1040644448_1040644460 7 Left 1040644448 8:49382094-49382116 CCCTCCCCGTGGCCAGGTGCACC No data
Right 1040644460 8:49382124-49382146 TCATCCGGTCCCTGGAATCTTGG No data
1040644454_1040644460 -5 Left 1040644454 8:49382106-49382128 CCAGGTGCACCCCTGGAGTCATC No data
Right 1040644460 8:49382124-49382146 TCATCCGGTCCCTGGAATCTTGG No data
1040644450_1040644460 3 Left 1040644450 8:49382098-49382120 CCCCGTGGCCAGGTGCACCCCTG No data
Right 1040644460 8:49382124-49382146 TCATCCGGTCCCTGGAATCTTGG No data
1040644451_1040644460 2 Left 1040644451 8:49382099-49382121 CCCGTGGCCAGGTGCACCCCTGG No data
Right 1040644460 8:49382124-49382146 TCATCCGGTCCCTGGAATCTTGG No data
1040644453_1040644460 1 Left 1040644453 8:49382100-49382122 CCGTGGCCAGGTGCACCCCTGGA No data
Right 1040644460 8:49382124-49382146 TCATCCGGTCCCTGGAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040644460 Original CRISPR TCATCCGGTCCCTGGAATCT TGG Intergenic
No off target data available for this crispr