ID: 1040652951

View in Genome Browser
Species Human (GRCh38)
Location 8:49470035-49470057
Sequence TAAGTATGAGGTCAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040652951_1040652955 9 Left 1040652951 8:49470035-49470057 CCCTGCAGCTGACCTCATACTTA No data
Right 1040652955 8:49470067-49470089 AACAAGATACTTTCTCCCTAAGG No data
1040652951_1040652956 13 Left 1040652951 8:49470035-49470057 CCCTGCAGCTGACCTCATACTTA No data
Right 1040652956 8:49470071-49470093 AGATACTTTCTCCCTAAGGTTGG No data
1040652951_1040652957 14 Left 1040652951 8:49470035-49470057 CCCTGCAGCTGACCTCATACTTA No data
Right 1040652957 8:49470072-49470094 GATACTTTCTCCCTAAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040652951 Original CRISPR TAAGTATGAGGTCAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr