ID: 1040658095

View in Genome Browser
Species Human (GRCh38)
Location 8:49535677-49535699
Sequence AAAAGGACCCCTGGGGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040658095_1040658102 1 Left 1040658095 8:49535677-49535699 CCACAAACCCCAGGGGTCCTTTT No data
Right 1040658102 8:49535701-49535723 GATTTCAGGATTCCTTTAAGAGG No data
1040658095_1040658103 11 Left 1040658095 8:49535677-49535699 CCACAAACCCCAGGGGTCCTTTT No data
Right 1040658103 8:49535711-49535733 TTCCTTTAAGAGGACTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040658095 Original CRISPR AAAAGGACCCCTGGGGTTTG TGG (reversed) Intergenic
No off target data available for this crispr