ID: 1040658102

View in Genome Browser
Species Human (GRCh38)
Location 8:49535701-49535723
Sequence GATTTCAGGATTCCTTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040658089_1040658102 14 Left 1040658089 8:49535664-49535686 CCTGGCCATGCTCCCACAAACCC No data
Right 1040658102 8:49535701-49535723 GATTTCAGGATTCCTTTAAGAGG No data
1040658098_1040658102 -7 Left 1040658098 8:49535685-49535707 CCCAGGGGTCCTTTTGGATTTCA No data
Right 1040658102 8:49535701-49535723 GATTTCAGGATTCCTTTAAGAGG No data
1040658099_1040658102 -8 Left 1040658099 8:49535686-49535708 CCAGGGGTCCTTTTGGATTTCAG No data
Right 1040658102 8:49535701-49535723 GATTTCAGGATTCCTTTAAGAGG No data
1040658097_1040658102 -6 Left 1040658097 8:49535684-49535706 CCCCAGGGGTCCTTTTGGATTTC No data
Right 1040658102 8:49535701-49535723 GATTTCAGGATTCCTTTAAGAGG No data
1040658094_1040658102 2 Left 1040658094 8:49535676-49535698 CCCACAAACCCCAGGGGTCCTTT No data
Right 1040658102 8:49535701-49535723 GATTTCAGGATTCCTTTAAGAGG No data
1040658091_1040658102 9 Left 1040658091 8:49535669-49535691 CCATGCTCCCACAAACCCCAGGG No data
Right 1040658102 8:49535701-49535723 GATTTCAGGATTCCTTTAAGAGG No data
1040658095_1040658102 1 Left 1040658095 8:49535677-49535699 CCACAAACCCCAGGGGTCCTTTT No data
Right 1040658102 8:49535701-49535723 GATTTCAGGATTCCTTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040658102 Original CRISPR GATTTCAGGATTCCTTTAAG AGG Intergenic
No off target data available for this crispr