ID: 1040661657

View in Genome Browser
Species Human (GRCh38)
Location 8:49582516-49582538
Sequence GTGGTCACCCTGATGAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040661657_1040661669 9 Left 1040661657 8:49582516-49582538 CCGCCCCTCATCAGGGTGACCAC No data
Right 1040661669 8:49582548-49582570 TACTCTACATGGCAGGGCCTGGG No data
1040661657_1040661668 8 Left 1040661657 8:49582516-49582538 CCGCCCCTCATCAGGGTGACCAC No data
Right 1040661668 8:49582547-49582569 ATACTCTACATGGCAGGGCCTGG No data
1040661657_1040661663 -2 Left 1040661657 8:49582516-49582538 CCGCCCCTCATCAGGGTGACCAC No data
Right 1040661663 8:49582537-49582559 ACCAGGCCTGATACTCTACATGG No data
1040661657_1040661666 3 Left 1040661657 8:49582516-49582538 CCGCCCCTCATCAGGGTGACCAC No data
Right 1040661666 8:49582542-49582564 GCCTGATACTCTACATGGCAGGG No data
1040661657_1040661665 2 Left 1040661657 8:49582516-49582538 CCGCCCCTCATCAGGGTGACCAC No data
Right 1040661665 8:49582541-49582563 GGCCTGATACTCTACATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040661657 Original CRISPR GTGGTCACCCTGATGAGGGG CGG (reversed) Intergenic
No off target data available for this crispr